PIGS (phosphatidylinositol glycan anchor biosynthesis class S)

Gene
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
94005
Gene name Gene Name - the full gene name approved by the HGNC.
Phosphatidylinositol glycan anchor biosynthesis class S
Gene symbol Gene Symbol - the official gene symbol approved by the HGNC.
PIGS
Synonyms (NCBI Gene) Gene synonyms aliases
DEE95, GPIBD18, PIG-S
Chromosome Chromosome number
17
Chromosome location Chromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
17q11.2
Summary Summary of gene provided in NCBI Entrez Gene.
This gene encodes a protein that is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes an essential component of
SNPs SNP information provided by dbSNP.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all(5)
SNP ID Visualize variation Clinical significance Consequence
rs1263517814 C>T Likely-pathogenic Coding sequence variant, stop gained
rs1426262136 T>C Likely-pathogenic Missense variant, coding sequence variant
rs1567614073 TTGCCCAGAAGCTGCGCCAGGGAGGTAAGGGTGGTGG>AGCAACC Pathogenic Coding sequence variant, inframe indel
rs1567616570 C>G Pathogenic Splice donor variant
rs1567618413 A>G Likely-pathogenic Coding sequence variant, missense variant
miRNA miRNA information provided by mirtarbase database.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all(1091)
miRTarBase ID miRNA Experiments Reference
MIRT023832 hsa-miR-1-3p Proteomics 18668040
MIRT051472 hsa-let-7e-5p CLASH 23622248
MIRT050805 hsa-miR-17-5p CLASH 23622248
MIRT049567 hsa-miR-92a-3p CLASH 23622248
MIRT043511 hsa-miR-331-3p CLASH 23622248
Gene ontology (GO) Gene ontology information of associated ontologies with gene provided by GO database.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all(19)
GO ID Ontology Definition Evidence Reference
GO:0005515 Function Protein binding IPI 11483512, 12802054, 25416956, 32296183, 33961781
GO:0005783 Component Endoplasmic reticulum IEA
GO:0005789 Component Endoplasmic reticulum membrane IEA
GO:0005789 Component Endoplasmic reticulum membrane NAS 12802054
GO:0005789 Component Endoplasmic reticulum membrane TAS
Other IDs Other ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
MIM HGNC e!Ensembl
610271 14937 ENSG00000087111
Protein
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
UniProt ID Q96S52
Protein name GPI-anchor transamidase component PIGS (Phosphatidylinositol-glycan biosynthesis class S protein)
Protein function Component of the glycosylphosphatidylinositol-anchor (GPI-anchor) transamidase (GPI-T) complex that catalyzes the formation of the linkage between a proprotein and a GPI-anchor and participates in GPI anchored protein biosynthesis. {ECO:0000269|
PDB 7W72 , 7WLD , 8IMX , 8IMY
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF10510 PIG-S 22 → 547 Phosphatidylinositol-glycan biosynthesis class S protein Family
Sequence
Sequence length 555
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
  KEGG   Reactome
  Glycosylphosphatidylinositol (GPI)-anchor biosynthesis
Metabolic pathways 		  Attachment of GPI anchor to uPAR
<
Associated diseases Disease associations categorized as Causal (pathogenic variants), Unknown (uncertain genetic evidence), or Text Mining (literature-based associations)
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide Causal Diseases (1)
Causal Diseases caused by PATHOGENIC or LIKELY PATHOGENIC variants from ClinVar only
Disease merge term Disease name dbSNP ID References
Glycosylphosphatidylinositol deficiency glycosylphosphatidylinositol biosynthesis defect 18 rs1263517814, rs1567618413, rs1567614073, rs1426262136, rs1567616570 N/A
Show/Hide Text Mining Associations (9)
Associations from Text Mining Disease associations identified through Pubtator
Disease Name Relationship Type References
Ataxia Associate 30269814
Breast Neoplasms Associate 18487995
Developmental Disabilities Associate 30269814
Glycosylphosphatidylinositol deficiency Associate 30269814
Immunologic Deficiency Syndromes Associate 30269814
Muscle Hypotonia Associate 30269814
Muscle Weakness Associate 30269814
Neoplastic Syndromes Hereditary Associate 30269814
Thakker Donnai syndrome Associate 30269814