Gene
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
79143
Gene name Gene Name - the full gene name approved by the HGNC.
Membrane bound acylglycerophosphatidylinositol O-acyltransferase MBOAT7
Gene symbol Gene Symbol - the official gene symbol approved by the HGNC.
MBOAT7
Synonyms (NCBI Gene) Gene synonyms aliases
BB1, LENG4, LPIAT, LPIAT1, LPLAT, LPLAT11, LRC4, MBOA7, MRT57, OACT7, hMBOA-7
Disease Acronyms (UniProt) Disease acronyms from UniProt database
MRT57
Chromosome Chromosome number
19
Chromosome location Chromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
19q13.42
Summary Summary of gene provided in NCBI Entrez Gene.
This gene encodes a member of the membrane-bound O-acyltransferases family of integral membrane proteins that have acyltransferase activity. The encoded protein is a lysophosphatidylinositol acyltransferase that has specificity for arachidonoyl-CoA as an
SNPs SNP information provided by dbSNP.
SNP ID Visualize variation Clinical significance Consequence
rs750035706 GCAGCCGCACTCGGCGGCAAT>- Pathogenic Coding sequence variant, inframe deletion
rs886041059 C>- Pathogenic Frameshift variant, coding sequence variant
rs886041060 C>G Pathogenic Splice donor variant
rs886041061 GGCCGCC>- Pathogenic Frameshift variant, coding sequence variant
rs1600651595 TGCAGCCGCACTC>- Pathogenic Frameshift variant, coding sequence variant
miRNA miRNA information provided by mirtarbase database.
miRTarBase ID miRNA Experiments Reference
MIRT031240 hsa-miR-19b-3p Sequencing 20371350
MIRT041731 hsa-miR-484 CLASH 23622248
MIRT039960 hsa-miR-615-3p CLASH 23622248
MIRT1135927 hsa-miR-1205 CLIP-seq
MIRT1135928 hsa-miR-1245b-3p CLIP-seq
Gene ontology (GO) Gene ontology information of associated ontologies with gene provided by GO database.
GO ID Ontology Definition Evidence Reference
GO:0003841 Function 1-acylglycerol-3-phosphate O-acyltransferase activity TAS
GO:0005515 Function Protein binding IPI 21903422, 23510452
GO:0005783 Component Endoplasmic reticulum IDA 30959108
GO:0005789 Component Endoplasmic reticulum membrane TAS
GO:0006661 Process Phosphatidylinositol biosynthetic process IBA 21873635
Other IDs Other ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
MIM HGNC e!Ensembl
606048 15505 ENSG00000125505
Protein
UniProt ID Q96N66
Protein name Membrane-bound acylglycerophosphatidylinositol O-acyltransferase MBOAT7 (EC 2.3.1.-) (1-acylglycerophosphatidylinositol O-acyltransferase) (Bladder and breast carcinoma-overexpressed gene 1 protein) (Leukocyte receptor cluster member 4) (Lysophosphatidyli
Protein function Acyltransferase which catalyzes the transfer of an acyl group from an acyl-CoA to a lysophosphatidylinositol (1-acylglycerophosphatidylinositol or LPI) leading to the production of a phosphatidylinositol (1,2-diacyl-sn-glycero-3-phosphoinositol
PDB 8ERC
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF03062 MBOAT 63 422 MBOAT, membrane-bound O-acyltransferase family Family
Tissue specificity TISSUE SPECIFICITY: Overexpressed in metastatic breast and bladder carcinomas relative to normal breast epithelium and urothelium. {ECO:0000269|PubMed:18772128}.
Sequence
Sequence length 472
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
  KEGG   Reactome
  Glycerophospholipid metabolism   Acyl chain remodelling of PI
Associated diseases Disease information provided by ClinVar, GenCC, and GWAS databases.
Causal
Disease term Disease name dbSNP ID References
Autism Autistic behavior rs121964908, rs62643608, rs181327458, rs797046134, rs869312704, rs1555013332, rs876657679, rs1057518999, rs1057518658, rs771827120, rs1555187899, rs773080572, rs753871454, rs1684130791, rs1684180699
View all (8 more)
Developmental delay Global developmental delay rs28941770, rs199469464, rs281865469, rs143747297, rs398123009, rs587777428, rs786205133, rs606231459, rs797044854, rs797045027, rs864309504, rs878853160, rs886039902, rs886042046, rs886041291
View all (32 more)
Febrile seizures Febrile Convulsions rs121909761, rs121909672, rs121909673, rs121909674, rs1561645243, rs267606837, rs796052510, rs1553553485, rs1554097890, rs1554101202, rs1554098226, rs765574676, rs1045493304
Mental retardation Severe intellectual disability, Mild Mental Retardation, Moderate intellectual disability, Intellectual Disability, MENTAL RETARDATION, AUTOSOMAL RECESSIVE 57 rs5742905, rs267607136, rs267607137, rs2131714307, rs267607038, rs267607042, rs80338685, rs137853127, rs80338815, rs28940893, rs387906309, rs121908096, rs121908099, rs587784365, rs121918315
View all (1024 more)
23097495
Unknown
Disease term Disease name Evidence References Source
Mental depression Depressive disorder ClinVar
Non-Syndromic Intellectual Disability autosomal recessive non-syndromic intellectual disability GenCC
Associations from Text Mining
Disease Name Relationship Type References
Alcoholism Associate 26850495
Amblyopia Associate 31282596
Anxiety Associate 31282596
Anxiety Disorders Associate 31282596
Ataxia Associate 31282596, 34979703
Atherosclerosis Inhibit 37424875
Atrophy Associate 31282596
Attention Deficit Disorder with Hyperactivity Associate 31282596, 40116760
Autism Spectrum Disorder Associate 31282596, 40116760
Autistic Disorder Associate 27616480, 31852446, 32645526, 34979703