Gene Gene information from NCBI Gene database.
Entrez ID 79143
Gene name Membrane bound acylglycerophosphatidylinositol O-acyltransferase MBOAT7
Gene symbol MBOAT7
Synonyms (NCBI Gene)
BB1LENG4LPIATLPIAT1LPLATLPLAT11LRC4MBOA7MRT57OACT7hMBOA-7
Chromosome 19
Chromosome location 19q13.42
Summary This gene encodes a member of the membrane-bound O-acyltransferases family of integral membrane proteins that have acyltransferase activity. The encoded protein is a lysophosphatidylinositol acyltransferase that has specificity for arachidonoyl-CoA as an
SNPs SNP information provided by dbSNP.
5
SNP ID Visualize variation Clinical significance Consequence
rs750035706 GCAGCCGCACTCGGCGGCAAT>- Pathogenic Coding sequence variant, inframe deletion
rs886041059 C>- Pathogenic Frameshift variant, coding sequence variant
rs886041060 C>G Pathogenic Splice donor variant
rs886041061 GGCCGCC>- Pathogenic Frameshift variant, coding sequence variant
rs1600651595 TGCAGCCGCACTC>- Pathogenic Frameshift variant, coding sequence variant
miRNA miRNA information provided by mirtarbase database.
192
miRTarBase ID miRNA Experiments Reference
MIRT031240 hsa-miR-19b-3p Sequencing 20371350
MIRT041731 hsa-miR-484 CLASH 23622248
MIRT039960 hsa-miR-615-3p CLASH 23622248
MIRT1135927 hsa-miR-1205 CLIP-seq
MIRT1135928 hsa-miR-1245b-3p CLIP-seq
Gene ontology (GO) Gene Ontology (GO) annotations describing the biological processes, molecular functions, and cellular components associated with a gene.
39
GO ID Ontology Definition Evidence Reference
GO:0003841 Function 1-acylglycerol-3-phosphate O-acyltransferase activity TAS
GO:0005515 Function Protein binding IPI 21903422, 23510452
GO:0005783 Component Endoplasmic reticulum IDA 30959108
GO:0005783 Component Endoplasmic reticulum IEA
GO:0005789 Component Endoplasmic reticulum membrane IEA
Other IDs Other IDs provides unique identifiers for this gene in OMIM, HGNC, and Ensembl databases.
MIM HGNC e!Ensembl
606048 15505 ENSG00000125505
Protein Protein information from UniProt database.
UniProt ID Unique identifier for the protein in the UniProt database. Click to view detailed protein information.
Q96N66
Protein name Membrane-bound acylglycerophosphatidylinositol O-acyltransferase MBOAT7 (EC 2.3.1.-) (1-acylglycerophosphatidylinositol O-acyltransferase) (Bladder and breast carcinoma-overexpressed gene 1 protein) (Leukocyte receptor cluster member 4) (Lysophosphatidyli
Protein function Acyltransferase which catalyzes the transfer of an acyl group from an acyl-CoA to a lysophosphatidylinositol (1-acylglycerophosphatidylinositol or LPI) leading to the production of a phosphatidylinositol (1,2-diacyl-sn-glycero-3-phosphoinositol
PDB 8ERC
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF03062 MBOAT 63 422 MBOAT, membrane-bound O-acyltransferase family Family
Tissue specificity TISSUE SPECIFICITY: Overexpressed in metastatic breast and bladder carcinomas relative to normal breast epithelium and urothelium. {ECO:0000269|PubMed:18772128}.
Sequence
Sequence length 472
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
  KEGG  Reactome
  Glycerophospholipid metabolism   Acyl chain remodelling of PI
Associated diseases Disease associations from ClinVar categorized as Causal (Pathogenic/Likely Pathogenic) or Unknown.
51
Causal Diseases associated with Pathogenic or Likely Pathogenic variants in ClinVar
Phenotype Name Clinical Significance dbSNP ID RCV Accession
Intellectual disability Likely pathogenic rs2076453977 RCV001291093
Intellectual disability, autosomal recessive 57 Likely pathogenic; Pathogenic rs1264222654, rs2076508722, rs868498080, rs2146989146, rs886041058, rs750035706, rs886041059, rs886041060, rs886041061, rs2515037913, rs2076013475, rs2076017638 RCV001449806
RCV001782418
RCV001795004
RCV001808107
RCV000258826
RCV000258838
RCV000258818
RCV000258829
RCV000258836
RCV003334371
RCV001250916
RCV001250919
MBOAT7-related disorder Likely pathogenic rs2515178934 RCV003964293
Neurodevelopmental abnormality Pathogenic rs2076013475 RCV005241246
Unknown Diseases with uncertain, conflicting, or no pathogenic evidence in ClinVar
Phenotype Name Clinical Significance dbSNP ID RCV Accession
Gastric cancer Uncertain significance rs748238566 RCV005937562
Thymoma Likely benign rs112360756 RCV005912251
Associations from Text MiningDisease associations identified through Pubtator
Disease Name Relationship Type References
Alcoholism Associate 26850495
Amblyopia Associate 31282596
Anxiety Associate 31282596
Anxiety Disorders Associate 31282596
Ataxia Associate 31282596, 34979703
Atherosclerosis Inhibit 37424875
Atrophy Associate 31282596
Attention Deficit Disorder with Hyperactivity Associate 31282596, 40116760
Autism Spectrum Disorder Associate 31282596, 40116760
Autistic Disorder Associate 27616480, 31852446, 32645526, 34979703