TRMT1 (tRNA methyltransferase 1)

Gene
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
55621
Gene name Gene Name - the full gene name approved by the HGNC.
TRNA methyltransferase 1
Gene symbol Gene Symbol - the official gene symbol approved by the HGNC.
TRMT1
Synonyms (NCBI Gene) Gene synonyms aliases
MRT68, TRM1, hTRM1
Disease Acronyms (UniProt) Disease acronyms from UniProt database
MRT68
Chromosome Chromosome number
19
Chromosome location Chromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
19p13.13
Summary Summary of gene provided in NCBI Entrez Gene.
This gene encodes a tRNA-modifying enzyme that acts as a dimethyltransferase, modifying a single guanine residue at position 26 of the tRNA. The encoded enzyme has both mono- and dimethylase activity when exogenously expressed, and uses S-adenosyl methion
SNPs SNP information provided by dbSNP.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all(5)
SNP ID Visualize variation Clinical significance Consequence
rs542184779 G>A Likely-pathogenic Coding sequence variant, non coding transcript variant, missense variant
rs746572548 ACGTCAAACCTCTCCGACACCCTCTGGTGCTG>- Pathogenic 5 prime UTR variant, frameshift variant, coding sequence variant, non coding transcript variant
rs1203487591 CA>- Pathogenic Frameshift variant, coding sequence variant, non coding transcript variant
rs1555716802 T>C Likely-pathogenic Splice acceptor variant
rs1568361011 C>A Pathogenic Splice donor variant
miRNA miRNA information provided by mirtarbase database.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all(4)
miRTarBase ID miRNA Experiments Reference
MIRT001584 hsa-let-7b-5p pSILAC 18668040
MIRT020603 hsa-miR-155-5p Proteomics 18668040
MIRT031488 hsa-miR-16-5p Proteomics 18668040
MIRT001584 hsa-let-7b-5p Proteomics;Other 18668040
Gene ontology (GO) Gene ontology information of associated ontologies with gene provided by GO database.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all(10)
GO ID Ontology Definition Evidence Reference
GO:0000049 Function TRNA binding IEA
GO:0002940 Process TRNA N2-guanine methylation IBA 21873635
GO:0003723 Function RNA binding HDA 22658674
GO:0004809 Function TRNA (guanine-N2-)-methyltransferase activity EXP 10982862
GO:0004809 Function TRNA (guanine-N2-)-methyltransferase activity IBA 21873635
Other IDs Other ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
MIM HGNC e!Ensembl
611669 25980 ENSG00000104907
Protein
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
UniProt ID Q9NXH9
Protein name tRNA (guanine(26)-N(2))-dimethyltransferase (EC 2.1.1.216) (tRNA 2,2-dimethylguanosine-26 methyltransferase) (tRNA methyltransferase 1) (hTRM1) (tRNA(guanine-26,N(2)-N(2)) methyltransferase) (tRNA(m(2,2)G26)dimethyltransferase)
Protein function Dimethylates a single guanine residue at position 26 of most nuclear- and mitochondrial-encoded tRNAs using S-adenosyl-L-methionine as donor of the methyl groups (PubMed:10982862, PubMed:28784718, PubMed:37204604, PubMed:39786990). tRNA guanine(
PDB 9DW6
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF02005 TRM 45 → 500 N2,N2-dimethylguanosine tRNA methyltransferase Family
PF00642 zf-CCCH 601 → 626 Zinc finger C-x8-C-x5-C-x3-H type (and similar) Family
Sequence
Sequence length 659
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
  Reactome
    tRNA modification in the nucleus and cytosol
Associated diseases Disease information provided by ClinVar, GenCC, and GWAS databases.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide Causal Diseases (4)
Causal
Disease term Disease name dbSNP ID References
Developmental delay Global developmental delay rs28941770, rs199469464, rs281865469, rs143747297, rs398123009, rs587777428, rs786205133, rs606231459, rs797044854, rs797045027, rs864309504, rs878853160, rs886039902, rs886042046, rs886041291
View all (32 more)		 28784718
Intellectual developmental disorder INTELLECTUAL DEVELOPMENTAL DISORDER, AUTOSOMAL RECESSIVE 68 rs587776937, rs397514627, rs542184779, rs869312859, rs879255628, rs886040957, rs1064795686, rs1135401779, rs868289171, rs1569507511, rs1561846159, rs141976414, rs746572548, rs1568361011, rs1203487591
View all (24 more)		 28784718
Mental retardation Profound Mental Retardation, Mental deficiency, Intellectual Disability rs5742905, rs267607136, rs267607137, rs2131714307, rs267607038, rs267607042, rs80338685, rs137853127, rs80338815, rs28940893, rs387906309, rs121908096, rs121908099, rs587784365, rs121918315
View all (1024 more)		 21937992, 28784718
Microcephaly Microcephaly rs397704721, rs267607176, rs267607177, rs397704725, rs267606717, rs267606718, rs199422202, rs121434311, rs199422203, rs199422126, rs387906274, rs121434305, rs199422125, rs199422135, rs189678019
View all (280 more)
Show/Hide Unknown Diseases (1)
Unknown
Disease term Disease name Evidence References Source
Intellectual Developmental Disorder intellectual developmental disorder, autosomal recessive 68 GenCC
Show/Hide Text Mining Associations (6)
Associations from Text Mining
Disease Name Relationship Type References
Breast Neoplasms Associate 35021009
Developmental Disabilities Associate 31898845
Drug Related Side Effects and Adverse Reactions Associate 36190452
Epilepsy Associate 31898845
Intellectual Disability Associate 26308914, 28784718, 31898845
Mental Retardation Autosomal Recessive 4 Associate 26308914