Gene Gene information from NCBI Gene database.
Entrez ID 5054
Gene name Serpin family E member 1
Gene symbol SERPINE1
Synonyms (NCBI Gene)
PAIPAI-1PAI1PLANH1
Chromosome 7
Chromosome location 7q22.1
Summary This gene encodes a member of the serine proteinase inhibitor (serpin) superfamily. This member is the principal inhibitor of tissue plasminogen activator (tPA) and urokinase (uPA), and hence is an inhibitor of fibrinolysis. The protein also functions as
SNPs SNP information provided by dbSNP.
4
SNP ID Visualize variation Clinical significance Consequence
rs1799762 ->G Pathogenic, other Upstream transcript variant
rs1194865614 ->TA Pathogenic Coding sequence variant, frameshift variant
rs1554362148 ->C Pathogenic Coding sequence variant, frameshift variant
rs1584902091 ACATGAGTTCATCTATTTCCTGCCCACATCTGGTATAAAAGGAGGCAGTGGCCCACAGAGGAGCACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTCCAGCAGCTGAATTCCTGCAGCTCAGCAGCCGCCGCCAGAGCAGGACGAACCGCCAATCGCAAGGCACCTCTGAGAACTTCAGGTAGGAGAAAAGCAAACTCCCTCCAACCTCTTACTTCGGGCTTAAGGCAG Likely-pathogenic 5 prime UTR variant, upstream transcript variant, intron variant, splice donor variant
miRNA miRNA information provided by mirtarbase database.
746
miRTarBase ID miRNA Experiments Reference
MIRT005844 hsa-miR-204-5p Microarray 21282569
MIRT005971 hsa-miR-30c-5p Luciferase reporter assay 21175428
MIRT005971 hsa-miR-30c-5p Luciferase reporter assay 21175428
MIRT005972 hsa-miR-301a-3p Luciferase reporter assay 21175428
MIRT005972 hsa-miR-301a-3p Luciferase reporter assay 21175428
Transcription factors Transcription factors information provided by TRRUST V2 database.
26
Transcription factor Regulation Reference
ARNTL2 Activation 22198637
E2F1 Repression 11402043;11559366
EPAS1 Activation 15039136
ESR1 Activation 15217907
ESR2 Repression 15217907
Gene ontology (GO) Gene Ontology (GO) annotations describing the biological processes, molecular functions, and cellular components associated with a gene.
59
GO ID Ontology Definition Evidence Reference
GO:0001525 Process Angiogenesis IEP 11866539
GO:0002020 Function Protease binding IPI 2503541, 8508955, 8626514, 12114510, 15853774
GO:0004866 Function Endopeptidase inhibitor activity IDA 8626514
GO:0004867 Function Serine-type endopeptidase inhibitor activity IBA
GO:0004867 Function Serine-type endopeptidase inhibitor activity IDA 1695900, 8508955, 21925150
Other IDs Other IDs provides unique identifiers for this gene in OMIM, HGNC, and Ensembl databases.
MIM HGNC e!Ensembl
173360 8583 ENSG00000106366
Protein Protein information from UniProt database.
UniProt ID Unique identifier for the protein in the UniProt database. Click to view detailed protein information.
P05121
Protein name Plasminogen activator inhibitor 1 (PAI) (PAI-1) (Endothelial plasminogen activator inhibitor) (Serpin E1)
Protein function Serine protease inhibitor. Inhibits TMPRSS7 (PubMed:15853774). Is a primary inhibitor of tissue-type plasminogen activator (PLAT) and urokinase-type plasminogen activator (PLAU). As PLAT inhibitor, it is required for fibrinolysis down-regulation
PDB 1A7C , 1B3K , 1C5G , 1DB2 , 1DVM , 1DVN , 1LJ5 , 1OC0 , 3CVM , 3EOX , 3PB1 , 3Q02 , 3Q03 , 3R4L , 3UT3 , 4AQH , 4G8O , 4G8R , 4IC0 , 5BRR , 5ZLZ , 6GWN , 6GWP , 6GWQ , 6I8S , 6ZRV , 7AQF , 7AQG , 9PAI
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF00079 Serpin 33 402 Serpin (serine protease inhibitor) Domain
Tissue specificity TISSUE SPECIFICITY: Expressed in endothelial cells (PubMed:2430793, PubMed:3097076). Found in plasma, platelets, and hepatoma and fibrosarcoma cells. {ECO:0000269|PubMed:2430793, ECO:0000269|PubMed:3097076}.
Sequence
Sequence length 402
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
  KEGG  Reactome
  HIF-1 signaling pathway
p53 signaling pathway
Cellular senescence
Apelin signaling pathway
Hippo signaling pathway
Complement and coagulation cascades
AGE-RAGE signaling pathway in diabetic complications
Chagas disease
  Platelet degranulation
BMAL1:CLOCK,NPAS2 activates circadian gene expression
SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
ECM proteoglycans
Dissolution of Fibrin Clot
Associated diseases Disease associations from ClinVar categorized as Causal (Pathogenic/Likely Pathogenic) or Unknown.
97
Causal Diseases associated with Pathogenic or Likely Pathogenic variants in ClinVar
Phenotype Name Clinical Significance dbSNP ID RCV Accession
Abnormal bleeding Likely pathogenic rs1584902091 RCV000852255
Congenital plasminogen activator inhibitor type 1 deficiency Pathogenic rs1194865614 RCV000014539
Transcription level of plasminogen activator inhibitor 1 Pathogenic rs1799762 RCV000014540
Unknown Diseases with uncertain, conflicting, or no pathogenic evidence in ClinVar
Phenotype Name Clinical Significance dbSNP ID RCV Accession
Gastrointestinal hemorrhage Uncertain significance rs2534997188 RCV002280954
Hemorrhage Uncertain significance rs1325311758, rs2534997188 RCV002280953
RCV003313810
SERPINE1-related disorder Benign; Likely benign; Uncertain significance rs6092, rs376407844, rs201351580, rs147003064, rs780207027 RCV003982840
RCV003922584
RCV003950273
RCV003923876
RCV003944022
Squamous cell carcinoma of the head and neck - rs995243543 RCV005931695
Associations from Text MiningDisease associations identified through Pubtator
Disease Name Relationship Type References
3 Methylglutaconic Aciduria Type I Stimulate 15158909
Abortion Habitual Associate 24189965, 24484533, 27504943, 30680517
Abortion Spontaneous Associate 24189965, 27504943, 29264983, 34360543, 35955896, 38057822
Acidosis Renal Tubular Associate 37758806
Acute Coronary Syndrome Stimulate 20061546
Acute Coronary Syndrome Associate 25788758, 35109843, 40257950
Acute Kidney Injury Associate 32496420
Acute Lung Injury Associate 19387177
Adenocarcinoma Associate 17264880
Adenocarcinoma of Lung Associate 35710585