Gene
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
359
Gene name Gene Name - the full gene name approved by the HGNC.
Aquaporin 2
Gene symbol Gene Symbol - the official gene symbol approved by the HGNC.
AQP2
Synonyms (NCBI Gene) Gene synonyms aliases
AQP-CD, NDI2, WCH-CD
Chromosome Chromosome number
12
Chromosome location Chromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
12q13.12
Summary Summary of gene provided in NCBI Entrez Gene.
This gene encodes a water channel protein located in the kidney collecting tubule. It belongs to the MIP/aquaporin family, some members of which are clustered together on chromosome 12q13. Mutations in this gene have been linked to autosomal dominant and
SNPs SNP information provided by dbSNP.
SNP ID Visualize variation Clinical significance Consequence
rs28931580 A>C Pathogenic Missense variant, coding sequence variant
rs104894336 C>G Pathogenic Coding sequence variant, missense variant
rs772201159 AACTGGCCACAGGCCCTGCCCTC>- Likely-pathogenic Coding sequence variant, frameshift variant
miRNA miRNA information provided by mirtarbase database.
miRTarBase ID miRNA Experiments Reference
MIRT491675 hsa-miR-4779 PAR-CLIP 23592263
MIRT491674 hsa-miR-6746-5p PAR-CLIP 23592263
MIRT491673 hsa-miR-4734 PAR-CLIP 23592263
MIRT491672 hsa-miR-3126-5p PAR-CLIP 23592263
MIRT491671 hsa-miR-6875-5p PAR-CLIP 23592263
Gene ontology (GO) Gene ontology information of associated ontologies with gene provided by GO database.
GO ID Ontology Definition Evidence Reference
GO:0003091 Process Renal water homeostasis IEA
GO:0003091 Process Renal water homeostasis IMP 8140421
GO:0003091 Process Renal water homeostasis TAS
GO:0003097 Process Renal water transport IEA
GO:0005372 Function Water transmembrane transporter activity IDA 8584435, 9321919
Other IDs Other ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
MIM HGNC e!Ensembl
107777 634 ENSG00000167580
Protein
UniProt ID P41181
Protein name Aquaporin-2 (AQP-2) (ADH water channel) (Aquaporin-CD) (AQP-CD) (Collecting duct water channel protein) (WCH-CD) (Water channel protein for renal collecting duct)
Protein function Forms a water-specific channel that provides the plasma membranes of renal collecting duct with high permeability to water, thereby permitting water to move in the direction of an osmotic gradient (PubMed:15509592, PubMed:7510718, PubMed:7524315
PDB 4NEF , 4OJ2 , 6QF5 , 8GCL , 8GHJ , 8OEE , 8VVX
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF00230 MIP 3 219 Major intrinsic protein Family
Tissue specificity TISSUE SPECIFICITY: Expressed in collecting tubules in kidney medulla (at protein level) (PubMed:7510718). Detected in kidney (PubMed:7510718). {ECO:0000269|PubMed:7510718}.
Sequence
Sequence length 271
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
  KEGG   Reactome
  Vasopressin-regulated water reabsorption   Vasopressin regulates renal water homeostasis via Aquaporins
Passive transport by Aquaporins
<
Associated diseases Disease associations categorized as Causal (pathogenic variants), Unknown (uncertain genetic evidence), or Text Mining (literature-based associations)
Causal Diseases caused by PATHOGENIC or LIKELY PATHOGENIC variants from ClinVar only
Disease merge term Disease name dbSNP ID References
Diabetes Insipidus Diabetes insipidus, nephrogenic, autosomal rs104894337, rs104894329, rs1565637179, rs370879515, rs1565637189, rs1131690792, rs1565636541, rs28931580, rs772201159, rs104894334, rs104894338, rs149659001, rs104894339, rs104894330, rs104894341
View all (7 more)
N/A
Nephrogenic Diabetes Insipidus nephrogenic diabetes insipidus rs193922496, rs104894328, rs370879515, rs104894329, rs104894334, rs770810694, rs104894341, rs193922494, rs193922495 N/A
Associations from Text Mining Disease associations identified through Pubtator
Disease Name Relationship Type References
Acute Kidney Injury Associate 33494641
Bardet Biedl Syndrome Associate 27488999
Cakut Associate 27151922
Carcinoma Renal Cell Associate 33494641, 35245343, 36117171, 36254092
Colorectal Neoplasms Associate 29799470
Diabetes Insipidus Associate 26714855
Diabetes Insipidus Nephrogenic Associate 14599123, 14709855, 15100362, 16361827, 16845277, 17954951, 19293543, 19461158, 20733335, 22474537, 26180540, 26714855, 27117808, 29799470, 29996815
View all (5 more)
Distal Myopathies Associate 32130259
Edema Associate 26261083
Endocrine System Diseases Associate 26180540