Gene
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
2775
Gene name Gene Name - the full gene name approved by the HGNC.
G protein subunit alpha o1
Gene symbol Gene Symbol - the official gene symbol approved by the HGNC.
GNAO1
Synonyms (NCBI Gene) Gene synonyms aliases
DEE17, EIEE17, G-ALPHA-o, GNAO, HG1G, HLA-DQB1, NEDIM
Chromosome Chromosome number
16
Chromosome location Chromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
16q13
Summary Summary of gene provided in NCBI Entrez Gene.
The protein encoded by this gene represents the alpha subunit of the Go heterotrimeric G-protein signal-transducing complex. Defects in this gene are a cause of early-onset epileptic encephalopathy. Two transcript variants encoding different isoforms have
SNPs SNP information provided by dbSNP.
SNP ID Visualize variation Clinical significance Consequence
rs587777054 T>A Pathogenic Missense variant, genic downstream transcript variant, coding sequence variant
rs587777055 A>G Pathogenic Missense variant, coding sequence variant
rs587777056 CATTCAAGAACCTCCACTTCA>- Pathogenic Inframe deletion, coding sequence variant
rs587777057 G>A,C Pathogenic Missense variant, coding sequence variant
rs797044878 G>A,T Uncertain-significance, likely-pathogenic, pathogenic Coding sequence variant, missense variant
miRNA miRNA information provided by mirtarbase database.
miRTarBase ID miRNA Experiments Reference
MIRT1023483 hsa-miR-1231 CLIP-seq
MIRT1023484 hsa-miR-1285 CLIP-seq
MIRT1023485 hsa-miR-151-3p CLIP-seq
MIRT1023486 hsa-miR-3119 CLIP-seq
MIRT1023487 hsa-miR-3150a-3p CLIP-seq
Gene ontology (GO) Gene ontology information of associated ontologies with gene provided by GO database.
GO ID Ontology Definition Evidence Reference
GO:0000166 Function Nucleotide binding IEA
GO:0003924 Function GTPase activity IBA
GO:0003924 Function GTPase activity IEA
GO:0003924 Function GTPase activity TAS 1899283
GO:0003925 Function G protein activity IEA
Other IDs Other ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
MIM HGNC e!Ensembl
139311 4389 ENSG00000087258
Protein
UniProt ID P09471
Protein name Guanine nucleotide-binding protein G(o) subunit alpha (EC 3.6.5.-)
Protein function Guanine nucleotide-binding proteins (G proteins) function as transducers downstream of G protein-coupled receptors (GPCRs) in numerous signaling cascades (PubMed:29925951, PubMed:33408414). The alpha chain contains the guanine nucleotide binding
PDB 6FUF , 6G79 , 6K41 , 6OIK , 6WWZ , 7D76 , 7D77 , 7EJ0 , 7EJ8 , 7EJA , 7EJK , 7QVM , 7T8X , 7T90 , 7T94 , 7T96 , 7W2Z , 7W6P , 7W7E , 7XJJ , 7Y24 , 8DZQ , 8E9X , 8FN1 , 8HPT , 8HQC , 8I95 , 8I97 , 8I9L , 8I9S , 8IA2 , 8IEC , 8IED , 8IY9 , 8IYH , 8IYW , 8J6D , 8JER , 8JHN , 8JZP , 8JZZ , 8TZQ , 8U02 , 8XWV , 8XX3 , 8XX6 , 8XX7 , 8XXH , 8XXR , 8XXX , 8XXZ
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF00503 G-alpha 13 343 G-protein alpha subunit Domain
Sequence
Sequence length 354
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
  KEGG   Reactome
  Rap1 signaling pathway
Hormone signaling
Circadian entrainment
Retrograde endocannabinoid signaling
Glutamatergic synapse
Cholinergic synapse
Serotonergic synapse
GABAergic synapse
Dopaminergic synapse
Long-term depression
Estrogen signaling pathway
Melanogenesis
Oxytocin signaling pathway
Relaxin signaling pathway
Morphine addiction
Alcoholism
Chagas disease
Toxoplasmosis
Human cytomegalovirus infection
Human immunodeficiency virus 1 infection
  PLC beta mediated events
G-protein activation
Ca2+ pathway
Cooperation of PDCL (PhLP1) and TRiC/CCT in G-protein beta folding
<
Associated diseases Disease associations categorized as Causal (pathogenic variants), Unknown (uncertain genetic evidence), or Text Mining (literature-based associations)
Causal Diseases caused by PATHOGENIC or LIKELY PATHOGENIC variants from ClinVar only
Disease merge term Disease name dbSNP ID References
Developmental And Epileptic Encephalopathy Developmental and epileptic encephalopathy, 17, Developmental and epileptic encephalopathy, 1 rs886041715, rs587777056, rs1555499800, rs1057518678, rs1596867702, rs1555508316, rs587777057, rs797044951, rs886041766, rs1085307876, rs587777054, rs2037919953, rs587777055, rs886039494, rs797044878
View all (1 more)
N/A
Epileptic Encephalopathy early infantile epileptic encephalopathy with suppression bursts rs797044878, rs886041715, rs1555507477, rs1555499800, rs1064794533, rs1064795384, rs1596872804, rs797044951, rs1085307876, rs758779535, rs2037920694, rs869312939, rs2037920791, rs886039494, rs1596787821
View all (1 more)
N/A
Neurodevelopmental Disorder With Involuntary Movements neurodevelopmental disorder with involuntary movements rs797044878, rs797044951, rs1555507479, rs1085307876, rs886039494, rs886041766, rs1114167431, rs587777055 N/A
Unknown Includes: (1) ClinVar NON-pathogenic variants (Uncertain, Benign, Conflicting, VUS), (2) GenCC associations, (3) GWAS associations, (4) CBGDA evidence-based associations. NOTE: Diseases with pathogenic evidence are excluded to avoid conflicts.
Disease merge term Disease name Evidence References Source
Insomnia Insomnia N/A N/A GWAS
Mental retardation intellectual disability N/A N/A ClinVar
Movement Disorders movement disorder N/A N/A GenCC
Neuroticism Neuroticism N/A N/A GWAS
Associations from Text Mining Disease associations identified through Pubtator
Disease Name Relationship Type References
Adenocarcinoma Associate 28350845
Atrial Fibrillation Associate 37960721
Autism Spectrum Disorder Associate 22965006
Brain Diseases Associate 25014031, 27072799, 27476654, 28747448, 28817111, 30682224, 34685729, 35722775, 36980817, 37001522, 37887313
Breast Neoplasms Associate 26894955
Carcinogenesis Associate 23984917, 28350845
Carcinoma Hepatocellular Associate 23984917
Carcinoma Hepatocellular Inhibit 34900204
Carcinoma Renal Cell Associate 26043775
Cerebral Palsy Associate 35076175, 37034444