AMH (anti-Mullerian hormone)

Gene
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
268
Gene name Gene Name - the full gene name approved by the HGNC.
Anti-Mullerian hormone
Gene symbol Gene Symbol - the official gene symbol approved by the HGNC.
AMH
Synonyms (NCBI Gene) Gene synonyms aliases
MIF, MIS
Chromosome Chromosome number
19
Chromosome location Chromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
19p13.3
Summary Summary of gene provided in NCBI Entrez Gene.
This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate
SNPs SNP information provided by dbSNP.
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all(2)
SNP ID Visualize variation Clinical significance Consequence
rs267606654 G>A,T Pathogenic Missense variant, coding sequence variant, stop gained
rs397518444 ->AGCTCAGCGTAGACCTCCGCGCC Pathogenic Stop gained, coding sequence variant, inframe indel
miRNA miRNA information provided by mirtarbase database.
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all(2)
miRTarBase ID miRNA Experiments Reference
MIRT732860 hsa-miR-100-5p Microarray, qRT-PCR 34172798
MIRT732861 hsa-miR-21-5p Microarray, qRT-PCR 34172798
Transcription factors
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all(14)
Transcription factor Regulation Reference
ESR1 Activation 13678390
GATA4 Activation 11097782;21220346
GATA4 Unknown 10446911
NFKB1 Activation 15383177
NR0B1 Repression 11990799
Gene ontology (GO) Gene ontology information of associated ontologies with gene provided by GO database.
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all(23)
GO ID Ontology Definition Evidence Reference
GO:0001546 Process Preantral ovarian follicle growth IEA
GO:0001655 Process Urogenital system development IBA 21873635
GO:0001880 Process Mullerian duct regression IBA 21873635
GO:0001880 Process Mullerian duct regression IDA 14695376
GO:0001880 Process Mullerian duct regression NAS 14750901
Other IDs Other ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
MIM HGNC e!Ensembl
600957 464 ENSG00000104899
Protein
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
UniProt ID P03971
Protein name Muellerian-inhibiting factor (Anti-Muellerian hormone) (AMH) (Muellerian-inhibiting substance) (MIS)
Protein function Plays an important role in several reproductive functions. Induces Muellerian duct regression during male fetal sexual differentiation (PubMed:34155118, PubMed:3754790, PubMed:8469238). Also plays a role in Leydig cell differentiation and functi
PDB 7L0J
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF04709 AMH_N 77 → 442 Anti-Mullerian hormone, N terminal region Family
PF00019 TGF_beta 461 → 559 Transforming growth factor beta like domain Domain
Tissue specificity TISSUE SPECIFICITY: In ovaries, AMH is detected in granulosa cells of early growing follicles. {ECO:0000269|PubMed:14742691}.
Sequence
Sequence length 560
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
  KEGG   Reactome
  cAMP signaling pathway
Cytokine-cytokine receptor interaction
Hormone signaling
TGF-beta signaling pathway
Hippo signaling pathway 		  Signaling by BMP
Associated diseases Disease information provided by ClinVar, GenCC, and GWAS databases.
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide Causal Diseases (2)
Causal
Disease term Disease name dbSNP ID References
Cryptorchidism Cryptorchidism rs121912555, rs104894697, rs104894698, rs398122886
Persistent mullerian duct syndrome Persistent Müllerian duct syndrome rs267606654, rs774592796, rs104894666, rs397518444, rs763798144, rs764761319, rs1939497801, rs137853104, rs781745214
Show/Hide Unknown Diseases (1)
Unknown
Disease term Disease name Evidence References Source
Persistent Mullerian Duct Syndrome persistent Mullerian duct syndrome GenCC
Show/Hide Text Mining Associations (84)
Associations from Text Mining
Disease Name Relationship Type References
47 XYY syndrome Associate 32544298
Abortion Habitual Associate 30917731
Abortion Spontaneous Associate 30917731
Allanson Pantzar McLeod syndrome Inhibit 37409232
Allanson Pantzar McLeod syndrome Associate 8623936
Amenorrhea Associate 35236324, 37698031
Androgen Insensitivity Syndrome Associate 20971460, 32345305
Anorchia Associate 21853106
Anovulation Associate 24606085, 28454499, 29426356
Anxiety Associate 34101147