Gene
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
2188
Gene name Gene Name - the full gene name approved by the HGNC.
FA complementation group F
Gene symbol Gene Symbol - the official gene symbol approved by the HGNC.
FANCF
Synonyms (NCBI Gene) Gene synonyms aliases
FAF
Chromosome Chromosome number
11
Chromosome location Chromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
11p14.3
Summary Summary of gene provided in NCBI Entrez Gene.
The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FAN
SNPs SNP information provided by dbSNP.
SNP ID Visualize variation Clinical significance Consequence
rs104894222 G>A,C Pathogenic Stop gained, coding sequence variant, synonymous variant
rs587778340 AG>- Pathogenic, not-provided Coding sequence variant, frameshift variant
rs730880277 AGTTCGCTAATCCCGGAACTGGA>- Pathogenic Coding sequence variant, frameshift variant
rs730880278 CTCTCTTGGAGTGTCTCCTCATCGGCGTCCCGGACGCCCGGGCCGGG>- Pathogenic Coding sequence variant, frameshift variant
rs747622521 A>- Likely-pathogenic Frameshift variant, coding sequence variant
miRNA miRNA information provided by mirtarbase database.
miRTarBase ID miRNA Experiments Reference
MIRT672169 hsa-miR-4755-3p HITS-CLIP 23824327
MIRT672170 hsa-miR-4284 HITS-CLIP 23824327
MIRT672168 hsa-miR-24-3p HITS-CLIP 23824327
MIRT672167 hsa-miR-2052 HITS-CLIP 23824327
MIRT672166 hsa-miR-19a-5p HITS-CLIP 23824327
Gene ontology (GO) Gene ontology information of associated ontologies with gene provided by GO database.
GO ID Ontology Definition Evidence Reference
GO:0000785 Component Chromatin IDA 22343915
GO:0005515 Function Protein binding IPI 11063725, 12649160, 32296183, 32814053
GO:0005634 Component Nucleus IEA
GO:0005654 Component Nucleoplasm IDA
GO:0005654 Component Nucleoplasm TAS
Other IDs Other ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
MIM HGNC e!Ensembl
613897 3587 ENSG00000183161
Protein
UniProt ID Q9NPI8
Protein name Fanconi anemia group F protein (Protein FACF)
Protein function DNA repair protein that may operate in a postreplication repair or a cell cycle checkpoint function. May be implicated in interstrand DNA cross-link repair and in the maintenance of normal chromosome stability (By similarity).
PDB 2IQC , 7KZP , 7KZQ , 7KZR , 7KZS , 7KZT , 7KZV
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF11107 FANCF 1 354 Fanconi anemia group F protein (FANCF) Family
Sequence
Sequence length 374
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
  KEGG   Reactome
  Fanconi anemia pathway   Fanconi Anemia Pathway
<
Associated diseases Disease associations categorized as Causal (pathogenic variants), Unknown (uncertain genetic evidence), or Text Mining (literature-based associations)
Causal Diseases caused by PATHOGENIC or LIKELY PATHOGENIC variants from ClinVar only
Disease merge term Disease name dbSNP ID References
Fanconi Anemia Fanconi anemia complementation group F, fanconi anemia rs747622521, rs745495865, rs730880277, rs1479457172, rs730880278, rs753272712, rs104894221, rs587778340, rs1858636931, rs104894222 N/A
Unknown Includes: (1) ClinVar NON-pathogenic variants (Uncertain, Benign, Conflicting, VUS), (2) GenCC associations, (3) GWAS associations, (4) CBGDA evidence-based associations. NOTE: Diseases with pathogenic evidence are excluded to avoid conflicts.
Disease merge term Disease name Evidence References Source
Breast Cancer Malignant tumor of breast N/A N/A ClinVar
hereditary cancer Hereditary cancer N/A N/A ClinVar
ovarian cancer Ovarian cancer N/A N/A ClinVar
Associations from Text Mining Disease associations identified through Pubtator
Disease Name Relationship Type References
Anemia Hemolytic Associate 11167740, 14617007, 16803569
Breast Diseases Associate 23440494
Breast Neoplasms Associate 17932744, 22952942, 23440494, 24345874
Carcinogenesis Associate 14617007
Carcinoma Non Small Cell Lung Associate 25828518
Carcinoma Squamous Cell Associate 29617660
Colorectal Neoplasms Associate 32915143
Fanconi Anemia Associate 11001585, 11750104, 12239156, 15256425, 16127171, 17082180, 19405097, 29973652, 31288759, 9382107
Fanconi Anemia Stimulate 23440494
Granulosa Cell Tumor Associate 15574200