Gene
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
11132
Gene name Gene Name - the full gene name approved by the HGNC.
Calpain 10
Gene symbol Gene Symbol - the official gene symbol approved by the HGNC.
CAPN10
Synonyms (NCBI Gene) Gene synonyms aliases
CANP10, NIDDM1
Chromosome Chromosome number
2
Chromosome location Chromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
2q37.3
Summary Summary of gene provided in NCBI Entrez Gene.
Calpains represent a ubiquitous, well-conserved family of calcium-dependent cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large catalytic subunit has four domains: domai
SNPs SNP information provided by dbSNP.
SNP ID Visualize variation Clinical significance Consequence
rs2975760 T>C Risk-factor Intron variant
rs3792267 G>A Risk-factor Intron variant
rs3842570 ->CGGGAGGAGGGTGATGATTCTGTCCCAGGAGC Risk-factor Intron variant
miRNA miRNA information provided by mirtarbase database.
miRTarBase ID miRNA Experiments Reference
MIRT2193326 hsa-miR-1289 CLIP-seq
MIRT2193327 hsa-miR-214 CLIP-seq
MIRT2193328 hsa-miR-3198 CLIP-seq
MIRT2193329 hsa-miR-3619-5p CLIP-seq
MIRT2193330 hsa-miR-4291 CLIP-seq
Transcription factors
Transcription factor Regulation Reference
RUNX3 Activation 17956589
Gene ontology (GO) Gene ontology information of associated ontologies with gene provided by GO database.
GO ID Ontology Definition Evidence Reference
GO:0000149 Function SNARE binding ISS
GO:0004198 Function Calcium-dependent cysteine-type endopeptidase activity IBA
GO:0004198 Function Calcium-dependent cysteine-type endopeptidase activity IEA
GO:0004198 Function Calcium-dependent cysteine-type endopeptidase activity IMP 15044459
GO:0005515 Function Protein binding IPI 32814053
Other IDs Other ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
MIM HGNC e!Ensembl
605286 1477 ENSG00000142330
Protein
UniProt ID Q9HC96
Protein name Calpain-10 (EC 3.4.22.-) (Calcium-activated neutral proteinase 10) (CANP 10)
Protein function Calcium-regulated non-lysosomal thiol-protease which catalyzes limited proteolysis of substrates involved in cytoskeletal remodeling and signal transduction. May play a role in insulin-stimulated glucose uptake.
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF00648 Peptidase_C2 14 319 Calpain family cysteine protease Family
PF01067 Calpain_III 344 486 Calpain large subunit, domain III Domain
PF01067 Calpain_III 521 643 Calpain large subunit, domain III Domain
Tissue specificity TISSUE SPECIFICITY: Detected in primary skeletal muscle cells (at protein level). Ubiquitous. {ECO:0000269|PubMed:17572128}.
Sequence
Sequence length 672
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
  Reactome
    Degradation of the extracellular matrix
<
Associated diseases Disease associations categorized as Causal (pathogenic variants), Unknown (uncertain genetic evidence), or Text Mining (literature-based associations)
Unknown Includes: (1) ClinVar NON-pathogenic variants (Uncertain, Benign, Conflicting, VUS), (2) GenCC associations, (3) GWAS associations, (4) CBGDA evidence-based associations. NOTE: Diseases with pathogenic evidence are excluded to avoid conflicts.
Disease merge term Disease name Evidence References Source
Bipolar Disorder Bipolar disorder, Bipolar I disorder N/A N/A GWAS
Diabetes Mellitus Type 2 diabetes mellitus 1, susceptibility to N/A N/A ClinVar
Neurodevelopmental Disorders neurodevelopmental disorder N/A N/A GenCC
Associations from Text Mining Disease associations identified through Pubtator
Disease Name Relationship Type References
Atherosclerosis Associate 19193380
Carcinoma Hepatocellular Associate 29991128
Cardiovascular Diseases Associate 18698425, 26376770
Cerebral Infarction Stimulate 28422847
Cerebral Small Vessel Diseases Associate 30014550
Cognition Disorders Associate 30014550
Colorectal Neoplasms Associate 24377587, 26203767
Cystic Fibrosis Associate 16377260
Diabetes Gestational Associate 31292430
Diabetes Mellitus Associate 11481585, 15454562, 15696418, 16377260, 19193380, 20178008, 24802731, 31292430, 38139275