CAPN10 (calpain 10)

Gene Gene information from NCBI Gene database.
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Entrez ID 11132
Gene name Calpain 10
Gene symbol CAPN10
Synonyms (NCBI Gene)
CANP10NIDDM1
Chromosome 2
Chromosome location 2q37.3
Summary Calpains represent a ubiquitous, well-conserved family of calcium-dependent cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large catalytic subunit has four domains: domai
SNPs SNP information provided by dbSNP.
3
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all (3)
SNP ID Visualize variation Clinical significance Consequence
rs2975760 T>C Risk-factor Intron variant
rs3792267 G>A Risk-factor Intron variant
rs3842570 ->CGGGAGGAGGGTGATGATTCTGTCCCAGGAGC Risk-factor Intron variant
miRNA miRNA information provided by mirtarbase database.
10
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all (10)
miRTarBase ID miRNA Experiments Reference
MIRT2193326 hsa-miR-1289 CLIP-seq
MIRT2193327 hsa-miR-214 CLIP-seq
MIRT2193328 hsa-miR-3198 CLIP-seq
MIRT2193329 hsa-miR-3619-5p CLIP-seq
MIRT2193330 hsa-miR-4291 CLIP-seq
Transcription factors Transcription factors information provided by TRRUST V2 database.
1
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all (1)
Transcription factor Regulation Reference
RUNX3 Activation 17956589
Gene ontology (GO) Gene Ontology (GO) annotations describing the biological processes, molecular functions, and cellular components associated with a gene.
32
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all (32)
GO ID Ontology Definition Evidence Reference
GO:0000149 Function SNARE binding ISS
GO:0004198 Function Calcium-dependent cysteine-type endopeptidase activity IBA
GO:0004198 Function Calcium-dependent cysteine-type endopeptidase activity IEA
GO:0004198 Function Calcium-dependent cysteine-type endopeptidase activity IMP 15044459
GO:0005515 Function Protein binding IPI 32814053
Other IDs Other IDs provides unique identifiers for this gene in OMIM, HGNC, and Ensembl databases.
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
MIM HGNC e!Ensembl
605286 1477 ENSG00000142330
Protein Protein information from UniProt database.
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
UniProt ID Unique identifier for the protein in the UniProt database. Click to view detailed protein information.
Q9HC96
Protein name Calpain-10 (EC 3.4.22.-) (Calcium-activated neutral proteinase 10) (CANP 10)
Protein function Calcium-regulated non-lysosomal thiol-protease which catalyzes limited proteolysis of substrates involved in cytoskeletal remodeling and signal transduction. May play a role in insulin-stimulated glucose uptake.
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF00648 Peptidase_C2 14 → 319 Calpain family cysteine protease Family
PF01067 Calpain_III 344 → 486 Calpain large subunit, domain III Domain
PF01067 Calpain_III 521 → 643 Calpain large subunit, domain III Domain
Tissue specificity TISSUE SPECIFICITY: Detected in primary skeletal muscle cells (at protein level). Ubiquitous. {ECO:0000269|PubMed:17572128}.
Sequence
Sequence length 672
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
  Reactome
    Degradation of the extracellular matrix
Associated diseases Disease associations from ClinVar categorized as Causal (Pathogenic/Likely Pathogenic) or Unknown.
24
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide Causal Diseases (1)
Causal Diseases associated with Pathogenic or Likely Pathogenic variants in ClinVar
Phenotype Name Clinical Significance dbSNP ID RCV Accession
CAPN10-related disorder Pathogenic rs2536286549 RCV003388180
Show/Hide Unknown Diseases (5)
Unknown Diseases with uncertain, conflicting, or no pathogenic evidence in ClinVar
Phenotype Name Clinical Significance dbSNP ID RCV Accession
Diabetes mellitus, noninsulin-dependent, 1 Uncertain significance rs1175724176 RCV002282758
Lung cancer Uncertain significance rs144696781 RCV005932621
Ovarian serous cystadenocarcinoma Uncertain significance rs144696781 RCV005932619
Thyroid cancer, nonmedullary, 1 Uncertain significance rs144696781 RCV005932620
Show/Hide Text Mining Associations (37)
Associations from Text MiningDisease associations identified through Pubtator
Disease Name Relationship Type References
Atherosclerosis Associate 19193380
Carcinoma Hepatocellular Associate 29991128
Cardiovascular Diseases Associate 18698425, 26376770
Cerebral Infarction Stimulate 28422847
Cerebral Small Vessel Diseases Associate 30014550
Cognition Disorders Associate 30014550
Colorectal Neoplasms Associate 24377587, 26203767
Cystic Fibrosis Associate 16377260
Diabetes Gestational Associate 31292430
Diabetes Mellitus Associate 11481585, 15454562, 15696418, 16377260, 19193380, 20178008, 24802731, 31292430, 38139275