Gene
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
10907
Gene name Gene Name - the full gene name approved by the HGNC.
Thioredoxin like 4A
Gene symbol Gene Symbol - the official gene symbol approved by the HGNC.
TXNL4A
Synonyms (NCBI Gene) Gene synonyms aliases
BMKS, DIB1, DIM1, SNRNP15, TXNL4, U5-15kD
Chromosome Chromosome number
18
Chromosome location Chromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
18q23
Summary Summary of gene provided in NCBI Entrez Gene.
The protein encoded by this gene is a member of the U5 small ribonucleoprotein particle (snRNP), and is involved in pre-mRNA splicing. This protein contains a thioredoxin-like fold and it is expected to interact with multiple proteins. Protein-protein int
SNPs SNP information provided by dbSNP.
SNP ID Visualize variation Clinical significance Consequence
rs535089924 CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATG>-,CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATG,CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATG Pathogenic Intron variant, upstream transcript variant, genic upstream transcript variant
rs727502793 C>A,T Pathogenic Non coding transcript variant, stop gained, coding sequence variant, missense variant
rs727502794 G>A Pathogenic Stop gained, coding sequence variant, non coding transcript variant, intron variant, 5 prime UTR variant
rs727502795 A>- Pathogenic Coding sequence variant, non coding transcript variant, intron variant, splice donor variant, frameshift variant, 5 prime UTR variant
rs786205699 CGCGCTAGCGCCGTGCGTGCTGACGGCATGTGCG>- Pathogenic Genic upstream transcript variant, intron variant, upstream transcript variant
miRNA miRNA information provided by mirtarbase database.
miRTarBase ID miRNA Experiments Reference
MIRT052139 hsa-let-7b-5p CLASH 23622248
MIRT050419 hsa-miR-23a-3p CLASH 23622248
MIRT041224 hsa-miR-193b-3p CLASH 23622248
MIRT036005 hsa-miR-1301-3p CLASH 23622248
MIRT712648 hsa-miR-6752-3p HITS-CLIP 19536157
Gene ontology (GO) Gene ontology information of associated ontologies with gene provided by GO database.
GO ID Ontology Definition Evidence Reference
GO:0000245 Process Spliceosomal complex assembly TAS 10610776
GO:0000375 Process RNA splicing, via transesterification reactions TAS 10610776
GO:0000398 Process MRNA splicing, via spliceosome IDA 28781166
GO:0000398 Process MRNA splicing, via spliceosome IEA
GO:0000398 Process MRNA splicing, via spliceosome NAS 30975767
Other IDs Other ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
MIM HGNC e!Ensembl
611595 30551 ENSG00000141759
Protein
UniProt ID P83876
Protein name Thioredoxin-like protein 4A (DIM1 protein homolog) (Spliceosomal U5 snRNP-specific 15 kDa protein) (Thioredoxin-like U5 snRNP protein U5-15kD)
Protein function Plays a role in pre-mRNA splicing as component of the U5 snRNP and U4/U6-U5 tri-snRNP complexes that are involved in spliceosome assembly, and as component of the precatalytic spliceosome (spliceosome B complex). {ECO:0000269|PubMed:28781166, EC
PDB 1PQN , 1QGV , 1SYX , 3JCR , 4BWQ , 4BWS , 4CDO , 5O9Z , 6AH0 , 6AHD , 6QW6 , 6QX9 , 8H6E , 8H6J , 8H6K , 8H6L , 8Q7N , 8QO9 , 8QOZ , 8QP8 , 8QP9 , 8QPA , 8QPB , 8QPE , 8QPK , 8QXD , 8QZS , 8R08 , 8R09 , 8R0A , 8R0B , 8RM5
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF02966 DIM1 4 136 Mitosis protein DIM1 Domain
Sequence
Sequence length 142
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
  KEGG   Reactome
  Spliceosome   mRNA Splicing - Major Pathway
mRNA Splicing - Minor Pathway
<
Associated diseases Disease associations categorized as Causal (pathogenic variants), Unknown (uncertain genetic evidence), or Text Mining (literature-based associations)
Unknown Includes: (1) ClinVar NON-pathogenic variants (Uncertain, Benign, Conflicting, VUS), (2) GenCC associations, (3) GWAS associations, (4) CBGDA evidence-based associations. NOTE: Diseases with pathogenic evidence are excluded to avoid conflicts.
Disease merge term Disease name Evidence References Source
Cardiac Defects choanal atresia-hearing loss-cardiac defects-craniofacial dysmorphism syndrome N/A N/A GenCC
Associations from Text Mining Disease associations identified through Pubtator
Disease Name Relationship Type References
Burn Mckeown syndrome Associate 28905882, 32735620
Choanal Atresia Associate 28905882
Developmental Disabilities Associate 32735620
Intellectual Disability Associate 32041777
Renpenning syndrome 1 Associate 32041777