Gene
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
286887
Gene name Gene Name - the full gene name approved by the HGNC.
Keratin 6C
Gene symbol Gene Symbol - the official gene symbol approved by the HGNC.
KRT6C
Synonyms (NCBI Gene) Gene synonyms aliases
K6E, KRT6E, PPKNEFD
Disease Acronyms (UniProt) Disease acronyms from UniProt database
PPKNEFD
Chromosome Chromosome number
12
Chromosome location Chromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
12q13.13
Summary Summary of gene provided in NCBI Entrez Gene.
Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq
SNPs SNP information provided by dbSNP.
SNP ID Visualize variation Clinical significance Consequence
rs267607474 TTG>- Pathogenic, not-provided Inframe deletion, coding sequence variant
rs267607475 GCAGCTTGCGGTAGGTGGCGATCTCCA>- Pathogenic, not-provided Inframe deletion, coding sequence variant
rs587777292 C>T Pathogenic Coding sequence variant, missense variant
miRNA miRNA information provided by mirtarbase database.
miRTarBase ID miRNA Experiments Reference
MIRT021778 hsa-miR-132-3p Microarray 17612493
MIRT1101383 hsa-miR-1275 CLIP-seq
MIRT1101384 hsa-miR-1321 CLIP-seq
MIRT1101385 hsa-miR-1908 CLIP-seq
MIRT1101386 hsa-miR-2115 CLIP-seq
Gene ontology (GO) Gene ontology information of associated ontologies with gene provided by GO database.
GO ID Ontology Definition Evidence Reference
GO:0005515 Function Protein binding IPI 25416956, 30021884, 32296183
GO:0005829 Component Cytosol TAS
GO:0005882 Component Intermediate filament NAS 9054461
GO:0031424 Process Keratinization TAS
GO:0045095 Component Keratin filament IEA
Other IDs Other ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
MIM HGNC e!Ensembl
612315 20406 ENSG00000170465
Protein
UniProt ID P48668
Protein name Keratin, type II cytoskeletal 6C (Cytokeratin-6C) (CK-6C) (Cytokeratin-6E) (CK-6E) (Keratin K6h) (Keratin-6C) (K6C) (Type-II keratin Kb12)
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF16208 Keratin_2_head 17 159 Keratin type II head Family
PF00038 Filament 162 475 Intermediate filament protein Coiled-coil
Tissue specificity TISSUE SPECIFICITY: Constitutively expressed in distinct types of epithelia such as those in oral mucosa, esophagus, papillae of tongue and hair follicle outer root sheath.
Sequence
Sequence length 564
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
  Reactome
    Keratinization
Formation of the cornified envelope
Associated diseases Disease information provided by ClinVar, GenCC, and GWAS databases.
Causal
Disease term Disease name dbSNP ID References
Palmoplantar keratoderma Keratoderma, Palmoplantar rs59616921, rs1568039793, rs746488412, rs200564757, rs1567027297, rs781596375, rs1567027610, rs398123054, rs398123055, rs398123056, rs398123057, rs398122949, rs398122950, rs397515639, rs398122951
View all (10 more)
Nonepidermolytic palmoplantar keratoderma PALMOPLANTAR KERATODERMA, NONEPIDERMOLYTIC, FOCAL 1, PALMOPLANTAR KERATODERMA, NONEPIDERMOLYTIC, FOCAL OR DIFFUSE rs59856285, rs60723330, rs1555573633, rs57977969, rs60447237, rs267607424, rs587777292 19609311, 23662636, 21801157
Associations from Text Mining
Disease Name Relationship Type References
Adenocarcinoma Associate 20839314
Carcinoma Basal Cell Associate 31047981
Carcinoma Squamous Cell Associate 20839314
Hyperkeratosis of the palms and soles and esophageal papillomas Associate 19609311
Keratoderma Palmoplantar Associate 19609311
Lung Neoplasms Associate 28619761
Neoplasms Associate 19509549
Pachyonychia Congenita Associate 24611874, 28648685, 34116063, 34724947, 36116508, 36658016