Gene
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
11181
Gene name Gene Name - the full gene name approved by the HGNC.
Trehalase
Gene symbol Gene Symbol - the official gene symbol approved by the HGNC.
TREH
Synonyms (NCBI Gene) Gene synonyms aliases
TRE, TREA, TREHD
Chromosome Chromosome number
11
Chromosome location Chromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
11q23.3
Summary Summary of gene provided in NCBI Entrez Gene.
This gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. A partial duplication of this gene is located adjacent to this locus on chromosome 11. Two transcript varia
SNPs SNP information provided by dbSNP.
SNP ID Visualize variation Clinical significance Consequence
rs527655595 GTGGCAGTAAATCTCACTGCAGAGAC>- Conflicting-interpretations-of-pathogenicity Splice acceptor variant, coding sequence variant, intron variant
miRNA miRNA information provided by mirtarbase database.
miRTarBase ID miRNA Experiments Reference
MIRT017846 hsa-miR-335-5p Microarray 18185580
Gene ontology (GO) Gene ontology information of associated ontologies with gene provided by GO database.
GO ID Ontology Definition Evidence Reference
GO:0004555 Function Alpha,alpha-trehalase activity IBA
GO:0004555 Function Alpha,alpha-trehalase activity IDA 8773341, 9427547
GO:0004555 Function Alpha,alpha-trehalase activity IEA
GO:0005886 Component Plasma membrane IEA
GO:0005886 Component Plasma membrane TAS 8773341
Other IDs Other ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
MIM HGNC e!Ensembl
275360 12266 ENSG00000118094
Protein
UniProt ID O43280
Protein name Trehalase (EC 3.2.1.28) (Alpha,alpha-trehalase) (Alpha,alpha-trehalose glucohydrolase)
Protein function Intestinal trehalase is probably involved in the hydrolysis of ingested trehalose.
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF01204 Trehalase 46 551 Trehalase Domain
Tissue specificity TISSUE SPECIFICITY: Expressed in kidney, liver and small intestine. Also more weakly expressed in pancreas. {ECO:0000269|PubMed:9427547}.
Sequence
Sequence length 583
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
  KEGG  
  Starch and sucrose metabolism
Metabolic pathways
 
<
Associated diseases Disease associations categorized as Causal (pathogenic variants), Unknown (uncertain genetic evidence), or Text Mining (literature-based associations)
Unknown Includes: (1) ClinVar NON-pathogenic variants (Uncertain, Benign, Conflicting, VUS), (2) GenCC associations, (3) GWAS associations, (4) CBGDA evidence-based associations. NOTE: Diseases with pathogenic evidence are excluded to avoid conflicts.
Disease merge term Disease name Evidence References Source
Trehalase Deficiency alpha, alpha-Trehalase deficiency, diarrhea-vomiting due to trehalase deficiency N/A N/A ClinVar, GenCC
Associations from Text Mining Disease associations identified through Pubtator
Disease Name Relationship Type References
Cartilage Diseases Associate 27701424
Diabetes Mellitus Associate 24625756
Diabetes Mellitus Type 2 Associate 23468175
Glioblastoma Associate 26156397
Trehalase Deficiency Associate 36880131