Gene Gene information from NCBI Gene database.
Entrez ID 9563
Gene name Hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase
Gene symbol H6PD
Synonyms (NCBI Gene)
CORTRD1G6PDHGDHH6PDH
Chromosome 1
Chromosome location 1p36.22
Summary There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific
SNPs SNP information provided by dbSNP.
5
SNP ID Visualize variation Clinical significance Consequence
rs387907167 G>A Pathogenic Coding sequence variant, missense variant
rs398122816 G>A Pathogenic Synonymous variant, coding sequence variant, intron variant
rs398122817 C>G Pathogenic Coding sequence variant, 5 prime UTR variant, stop gained
rs398122818 C>- Pathogenic Coding sequence variant, 5 prime UTR variant, frameshift variant
rs606231222 ->ACAGGTGGTTGACCTGTGGCCGGGTCTGA Pathogenic Stop gained, coding sequence variant, inframe indel
miRNA miRNA information provided by mirtarbase database.
1190
miRTarBase ID miRNA Experiments Reference
MIRT018427 hsa-miR-335-5p Microarray 18185580
MIRT022903 hsa-miR-124-3p Microarray 18668037
MIRT707244 hsa-miR-6732-3p HITS-CLIP 21572407
MIRT707243 hsa-miR-10a-5p HITS-CLIP 21572407
MIRT707242 hsa-miR-10b-5p HITS-CLIP 21572407
Gene ontology (GO) Gene Ontology (GO) annotations describing the biological processes, molecular functions, and cellular components associated with a gene.
32
GO ID Ontology Definition Evidence Reference
GO:0003824 Function Catalytic activity IEA
GO:0004345 Function Glucose-6-phosphate dehydrogenase activity IBA
GO:0004345 Function Glucose-6-phosphate dehydrogenase activity IDA 18628520, 23132696
GO:0004345 Function Glucose-6-phosphate dehydrogenase activity IEA
GO:0005783 Component Endoplasmic reticulum IBA
Other IDs Other IDs provides unique identifiers for this gene in OMIM, HGNC, and Ensembl databases.
MIM HGNC e!Ensembl
138090 4795 ENSG00000049239
Protein Protein information from UniProt database.
UniProt ID Unique identifier for the protein in the UniProt database. Click to view detailed protein information.
O95479
Protein name GDH/6PGL endoplasmic bifunctional protein [Includes: Hexose-6-phosphate dehydrogenase (Glucose 1-dehydrogenase) (GDH) (EC 1.1.1.47) (Glucose-6-phosphate dehydrogenase) (EC 1.1.1.363); 6-phosphogluconolactonase (6PGL) (EC 3.1.1.31)]
Protein function Bifunctional enzyme localized in the lumen of the endoplasmic reticulum that catalyzes the first two steps of the oxidative branch of the pentose phosphate pathway/shunt, an alternative to glycolysis and a major source of reducing power and meta
PDB 8EM2
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF00479 G6PD_N 29 213 Glucose-6-phosphate dehydrogenase, NAD binding domain Domain
PF02781 G6PD_C 215 515 Glucose-6-phosphate dehydrogenase, C-terminal domain Domain
PF01182 Glucosamine_iso 558 782 Glucosamine-6-phosphate isomerases/6-phosphogluconolactonase Domain
Tissue specificity TISSUE SPECIFICITY: Present in most tissues examined, strongest in liver. {ECO:0000269|PubMed:10349511}.
Sequence
Sequence length 791
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
  KEGG 
  Pentose phosphate pathway
Metabolic pathways
Carbon metabolism
 
Associated diseases Disease associations from ClinVar (causal & non-causal) and other databases (OMIM, Orphanet, GWAS, etc.).
16
Evidence Score: ★☆☆☆☆  Gene-disease association found in Text Mining only ★★☆☆☆  Found in Text Mining and Unknown/Other Associations ★★★☆☆  Reported in Unknown/Other Associations across ≥2 Sources ★★★★☆  ClinVar: Pathogenic/Likely Pathogenic (<5 Variants) ★★★★★  ClinVar: Pathogenic/Likely Pathogenic (≥5 Variants)
Causal Diseases associated with Pathogenic or Likely Pathogenic variants in ClinVar
Phenotype Name Clinical Significance dbSNP ID RCV Accession Evidence Score
Cortisone reductase deficiency 1 Pathogenic rs606231222, rs398122816, rs387907167, rs398122817, rs398122818 RCV000017510
RCV000024290
RCV000024291
RCV000024292
RCV000024293
★★★★★
ClinVar: Pathogenic / Likely Pathogenic (≥5 Variants)
Unknown / Other Associations ClinVar entries with uncertain/conflicting evidence, and associations from other databases (OMIM, Orphanet, GWAS, etc.) where the gene is not established as causal.
Phenotype Name Clinical Significance Source Evidence Score
ASTHMA GWAS catalog
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
ATOPIC ECZEMA GWAS catalog
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
BREAST NEOPLASMS CTD
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
Cervical cancer Benign ClinVar
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
Associations from Text Mining Disease associations identified through text mining
Disease Name Disease (Merged) Source PMID Relationship Type Evidence Score
Acne Acne HPO_DG
★☆☆☆☆
Found in Text Mining only
Anemia, Hemolytic Anemia LHGDN 16079115
★☆☆☆☆
Found in Text Mining only
Anemia, Hemolytic Anemia BEFREE 28556555
★☆☆☆☆
Found in Text Mining only
Arteriosclerosis Arteriosclerosis BEFREE 21858044
★☆☆☆☆
Found in Text Mining only
Atherosclerosis Atherosclerosis BEFREE 21858044
★☆☆☆☆
Found in Text Mining only
Atherosclerosis Atherosclerosis Pubtator 21858044 Associate
★☆☆☆☆
Found in Text Mining only
B-Cell Lymphomas B-Cell Lymphoma BEFREE 11485900
★☆☆☆☆
Found in Text Mining only
beta Thalassemia beta Thalassemia BEFREE 6766754
★☆☆☆☆
Found in Text Mining only
beta Thalassemia Beta thalassemia Pubtator 6766754 Associate
★☆☆☆☆
Found in Text Mining only
Breast Carcinoma Breast Carcinoma BEFREE 18204793, 29295867, 29682102, 29770168
★☆☆☆☆
Found in Text Mining only