Gene Gene information from NCBI Gene database.
Entrez ID 94005
Gene name Phosphatidylinositol glycan anchor biosynthesis class S
Gene symbol PIGS
Synonyms (NCBI Gene)
DEE95GPIBD18PIG-S
Chromosome 17
Chromosome location 17q11.2
Summary This gene encodes a protein that is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes an essential component of
SNPs SNP information provided by dbSNP.
5
SNP ID Visualize variation Clinical significance Consequence
rs1263517814 C>T Likely-pathogenic Coding sequence variant, stop gained
rs1426262136 T>C Likely-pathogenic Missense variant, coding sequence variant
rs1567614073 TTGCCCAGAAGCTGCGCCAGGGAGGTAAGGGTGGTGG>AGCAACC Pathogenic Coding sequence variant, inframe indel
rs1567616570 C>G Pathogenic Splice donor variant
rs1567618413 A>G Likely-pathogenic Coding sequence variant, missense variant
miRNA miRNA information provided by mirtarbase database.
1091
miRTarBase ID miRNA Experiments Reference
MIRT023832 hsa-miR-1-3p Proteomics 18668040
MIRT051472 hsa-let-7e-5p CLASH 23622248
MIRT050805 hsa-miR-17-5p CLASH 23622248
MIRT049567 hsa-miR-92a-3p CLASH 23622248
MIRT043511 hsa-miR-331-3p CLASH 23622248
Gene ontology (GO) Gene Ontology (GO) annotations describing the biological processes, molecular functions, and cellular components associated with a gene.
19
GO ID Ontology Definition Evidence Reference
GO:0005515 Function Protein binding IPI 11483512, 12802054, 25416956, 32296183, 33961781
GO:0005783 Component Endoplasmic reticulum IEA
GO:0005789 Component Endoplasmic reticulum membrane IEA
GO:0005789 Component Endoplasmic reticulum membrane NAS 12802054
GO:0005789 Component Endoplasmic reticulum membrane TAS
Other IDs Other IDs provides unique identifiers for this gene in OMIM, HGNC, and Ensembl databases.
MIM HGNC e!Ensembl
610271 14937 ENSG00000087111
Protein Protein information from UniProt database.
UniProt ID Unique identifier for the protein in the UniProt database. Click to view detailed protein information.
Q96S52
Protein name GPI-anchor transamidase component PIGS (Phosphatidylinositol-glycan biosynthesis class S protein)
Protein function Component of the glycosylphosphatidylinositol-anchor (GPI-anchor) transamidase (GPI-T) complex that catalyzes the formation of the linkage between a proprotein and a GPI-anchor and participates in GPI anchored protein biosynthesis. {ECO:0000269|
PDB 7W72 , 7WLD , 8IMX , 8IMY
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF10510 PIG-S 22 547 Phosphatidylinositol-glycan biosynthesis class S protein Family
Sequence
Sequence length 555
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
  KEGG  Reactome
  Glycosylphosphatidylinositol (GPI)-anchor biosynthesis
Metabolic pathways
  Attachment of GPI anchor to uPAR
Associated diseases Disease associations from ClinVar (causal & non-causal) and other databases (OMIM, Orphanet, GWAS, etc.).
3
Evidence Score: ★☆☆☆☆  Gene-disease association found in Text Mining only ★★☆☆☆  Found in Text Mining and Unknown/Other Associations ★★★☆☆  Reported in Unknown/Other Associations across ≥2 Sources ★★★★☆  ClinVar: Pathogenic/Likely Pathogenic (<5 Variants) ★★★★★  ClinVar: Pathogenic/Likely Pathogenic (≥5 Variants)
Causal Diseases associated with Pathogenic or Likely Pathogenic variants in ClinVar
Phenotype Name Clinical Significance dbSNP ID RCV Accession Evidence Score
Glycosylphosphatidylinositol biosynthesis defect 18 Pathogenic; Likely pathogenic rs1243182982, rs2070332383, rs2151511848, rs769890071, rs1249675321, rs1263517814, rs1567618413, rs1567614073, rs1426262136, rs1567616570 RCV001449569
RCV001449570
RCV001449571
RCV001449572
RCV001449573
View all (5 more)
★★★★★
ClinVar: Pathogenic / Likely Pathogenic (≥5 Variants)
Unknown / Other Associations ClinVar entries with uncertain/conflicting evidence, and associations from other databases (OMIM, Orphanet, GWAS, etc.) where the gene is not established as causal.
Phenotype Name Clinical Significance Source Evidence Score
DEVELOPMENTAL AND EPILEPTIC ENCEPHALOPATHY 95 Disgenet, HPO
Disgenet, HPO
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
PIGS-related disorder Benign; Likely benign ClinVar
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
Associations from Text Mining Disease associations identified through text mining
Disease Name Disease (Merged) Source PMID Relationship Type Evidence Score
Arthrogryposis Arthrogryposis multiplex congenita HPO_DG
★☆☆☆☆
Found in Text Mining only
Ataxia Ataxia Pubtator 30269814 Associate
★☆☆☆☆
Found in Text Mining only
Brachydactyly Brachydactyly HPO_DG
★☆☆☆☆
Found in Text Mining only
Breast Neoplasms Breast neoplasm Pubtator 18487995 Associate
★☆☆☆☆
Found in Text Mining only
Central visual impairment Central Visual Impairment HPO_DG
★☆☆☆☆
Found in Text Mining only
Cerebellar atrophy Cerebellar atrophy HPO_DG
★☆☆☆☆
Found in Text Mining only
Cerebral cortical atrophy Cerebral cortical atrophy HPO_DG
★☆☆☆☆
Found in Text Mining only
Clinodactyly of the 5th finger Camptodactyly of fingers HPO_DG
★☆☆☆☆
Found in Text Mining only
Congenital exomphalos Congenital Exomphalos HPO_DG
★☆☆☆☆
Found in Text Mining only
Congenital pectus carinatum Congenital Pectus Carinatum HPO_DG
★☆☆☆☆
Found in Text Mining only