AMH (anti-Mullerian hormone)

Gene Gene information from NCBI Gene database.
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Entrez ID 268
Gene name Anti-Mullerian hormone
Gene symbol AMH
Synonyms (NCBI Gene)
MIFMIS
Chromosome 19
Chromosome location 19p13.3
Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate
SNPs SNP information provided by dbSNP.
2
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all (2)
SNP ID Visualize variation Clinical significance Consequence
rs267606654 G>A,T Pathogenic Missense variant, coding sequence variant, stop gained
rs397518444 ->AGCTCAGCGTAGACCTCCGCGCC Pathogenic Stop gained, coding sequence variant, inframe indel
miRNA miRNA information provided by mirtarbase database.
2
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all (2)
miRTarBase ID miRNA Experiments Reference
MIRT732860 hsa-miR-100-5p MicroarrayqRT-PCR 34172798
MIRT732861 hsa-miR-21-5p MicroarrayqRT-PCR 34172798
Transcription factors Transcription factors information provided by TRRUST V2 database.
14
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all (14)
Transcription factor Regulation Reference
ESR1 Activation 13678390
GATA4 Activation 11097782;21220346
GATA4 Unknown 10446911
NFKB1 Activation 15383177
NR0B1 Repression 11990799
Gene ontology (GO) Gene Ontology (GO) annotations describing the biological processes, molecular functions, and cellular components associated with a gene.
38
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all (38)
GO ID Ontology Definition Evidence Reference
GO:0001541 Process Ovarian follicle development ISS
GO:0001546 Process Preantral ovarian follicle growth IEA
GO:0001655 Process Urogenital system development IEA
GO:0001880 Process Mullerian duct regression IBA
GO:0001880 Process Mullerian duct regression IDA 14695376
Other IDs Other IDs provides unique identifiers for this gene in OMIM, HGNC, and Ensembl databases.
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
MIM HGNC e!Ensembl
600957 464 ENSG00000104899
Protein Protein information from UniProt database.
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
UniProt ID Unique identifier for the protein in the UniProt database. Click to view detailed protein information.
P03971
Protein name Muellerian-inhibiting factor (Anti-Muellerian hormone) (AMH) (Muellerian-inhibiting substance) (MIS)
Protein function Plays an important role in several reproductive functions. Induces Muellerian duct regression during male fetal sexual differentiation (PubMed:34155118, PubMed:3754790, PubMed:8469238). Also plays a role in Leydig cell differentiation and functi
PDB 7L0J
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF04709 AMH_N 77 → 442 Anti-Mullerian hormone, N terminal region Family
PF00019 TGF_beta 461 → 559 Transforming growth factor beta like domain Domain
Tissue specificity TISSUE SPECIFICITY: In ovaries, AMH is detected in granulosa cells of early growing follicles. {ECO:0000269|PubMed:14742691}.
Sequence
Sequence length 560
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
  KEGG  Reactome
  cAMP signaling pathway
Cytokine-cytokine receptor interaction
Hormone signaling
TGF-beta signaling pathway
Hippo signaling pathway 		  Signaling by BMP
Associated diseases Disease associations from ClinVar (causal & non-causal) and other databases (OMIM, Orphanet, GWAS, etc.).
16
Gene SNPs miRNA Transcription factors Gene ontology Other IDs Protein Pathways Associated diseases
Evidence Score: ★☆☆☆☆  Gene-disease association found in Text Mining only ★★☆☆☆  Found in Text Mining and Unknown/Other Associations ★★★☆☆  Reported in Unknown/Other Associations across ≥2 Sources ★★★★☆  ClinVar: Pathogenic/Likely Pathogenic (<5 Variants) ★★★★★  ClinVar: Pathogenic/Likely Pathogenic (≥5 Variants)
Show/Hide Causal Diseases (3)
Causal Diseases associated with Pathogenic or Likely Pathogenic variants in ClinVar
Phenotype Name Clinical Significance dbSNP ID RCV Accession Evidence Score
Genetic non-acquired premature ovarian failure Likely pathogenic rs2145032534 RCV001663378
★★★★★
★★★★☆
ClinVar: Pathogenic / Likely Pathogenic (<5 Variants)
Persistent Mullerian duct syndrome Pathogenic; Likely pathogenic rs1443929462, rs1183532981, rs1415701260, rs104894666, rs2512014671, rs2025018868 RCV001783483
RCV001848599
RCV002471338
RCV004799735
RCV003990543
View all (1 more)
★★★★★
★★★★★
ClinVar: Pathogenic / Likely Pathogenic (≥5 Variants)
Persistent mullerian duct syndrome, type I Pathogenic rs267606654, rs774592796, rs104894666, rs397518444 RCV000009153
RCV000009155
RCV000009156
RCV000009157
★★★★★
★★★★☆
ClinVar: Pathogenic / Likely Pathogenic (<5 Variants)
Show/Hide Unknown Diseases (13)
Unknown / Other Associations ClinVar entries with uncertain/conflicting evidence, and associations from other databases (OMIM, Orphanet, GWAS, etc.) where the gene is not established as causal.
Phenotype Name Clinical Significance Source Evidence Score
Adrenocortical carcinoma, hereditary Benign ClinVar
★★★★★
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
AMH-related disorder Conflicting classifications of pathogenicity; Benign; Likely benign; Uncertain significance ClinVar
★★★★★
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
Cholangiocarcinoma Benign ClinVar
★★★★★
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
Colorectal cancer Benign ClinVar
★★★★★
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
Show/Hide Text Mining Associations (219)
Associations from Text Mining Disease associations identified through text mining
Disease Name Disease (Merged) Source PMID Relationship Type Evidence Score
Acromegaly Acromegaly BEFREE 29404901
★★★★★
★☆☆☆☆
Found in Text Mining only
Adenocarcinoma, Clear Cell Adenocarcinoma BEFREE 30884769
★★★★★
★☆☆☆☆
Found in Text Mining only
Adenocarcinoma, Endometrioid Endometrial Cancer BEFREE 30884769
★★★★★
★☆☆☆☆
Found in Text Mining only
Adrenal hyperplasia, congenital, type 5 Adrenal Hyperplasia, Congenital BEFREE 1769794
★★★★★
★☆☆☆☆
Found in Text Mining only
Ambiguous Genitalia Ambiguous Genitalia BEFREE 23044872
★★★★★
★☆☆☆☆
Found in Text Mining only
Amenorrhea Amenorrhea Pubtator 35236324, 37698031 Associate
★★★★★
★☆☆☆☆
Found in Text Mining only
Androgen Insensitivity Syndrome Androgen insensitivity syndrome Pubtator 20971460, 32345305 Associate
★★★★★
★☆☆☆☆
Found in Text Mining only
Androgen-Insensitivity Syndrome Androgen-Insensitivity Syndrome BEFREE 22469007, 24098470, 31637547
★★★★★
★☆☆☆☆
Found in Text Mining only
Anemia, Sickle Cell Anemia BEFREE 30794713
★★★★★
★☆☆☆☆
Found in Text Mining only
ANOPHTHALMIA AND PULMONARY HYPOPLASIA Syndromic microphthalmia BEFREE 25820398
★★★★★
★☆☆☆☆
Found in Text Mining only