TREH (trehalase)

Gene Gene information from NCBI Gene database.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Entrez ID 11181
Gene name Trehalase
Gene symbol TREH
Synonyms (NCBI Gene)
TRETREATREHD
Chromosome 11
Chromosome location 11q23.3
Summary This gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. A partial duplication of this gene is located adjacent to this locus on chromosome 11. Two transcript varia
SNPs SNP information provided by dbSNP.
1
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all (1)
SNP ID Visualize variation Clinical significance Consequence
rs527655595 GTGGCAGTAAATCTCACTGCAGAGAC>- Conflicting-interpretations-of-pathogenicity Splice acceptor variant, coding sequence variant, intron variant
miRNA miRNA information provided by mirtarbase database.
1
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all (1)
miRTarBase ID miRNA Experiments Reference
MIRT017846 hsa-miR-335-5p Microarray 18185580
Gene ontology (GO) Gene Ontology (GO) annotations describing the biological processes, molecular functions, and cellular components associated with a gene.
17
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Show/Hide all (17)
GO ID Ontology Definition Evidence Reference
GO:0004555 Function Alpha,alpha-trehalase activity IBA
GO:0004555 Function Alpha,alpha-trehalase activity IDA 8773341, 9427547
GO:0004555 Function Alpha,alpha-trehalase activity IEA
GO:0005886 Component Plasma membrane IEA
GO:0005886 Component Plasma membrane TAS 8773341
Other IDs Other IDs provides unique identifiers for this gene in OMIM, HGNC, and Ensembl databases.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
MIM HGNC e!Ensembl
275360 12266 ENSG00000118094
Protein Protein information from UniProt database.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
UniProt ID Unique identifier for the protein in the UniProt database. Click to view detailed protein information.
O43280
Protein name Trehalase (EC 3.2.1.28) (Alpha,alpha-trehalase) (Alpha,alpha-trehalose glucohydrolase)
Protein function Intestinal trehalase is probably involved in the hydrolysis of ingested trehalose.
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF01204 Trehalase 46 → 551 Trehalase Domain
Tissue specificity TISSUE SPECIFICITY: Expressed in kidney, liver and small intestine. Also more weakly expressed in pancreas. {ECO:0000269|PubMed:9427547}.
Sequence
Sequence length 583
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
  KEGG 
  Starch and sucrose metabolism
Metabolic pathways 		 
Associated diseases Disease associations from ClinVar (causal & non-causal) and other databases (OMIM, Orphanet, GWAS, etc.).
3
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Evidence Score: ★☆☆☆☆  Gene-disease association found in Text Mining only ★★☆☆☆  Found in Text Mining and Unknown/Other Associations ★★★☆☆  Reported in Unknown/Other Associations across ≥2 Sources ★★★★☆  ClinVar: Pathogenic/Likely Pathogenic (<5 Variants) ★★★★★  ClinVar: Pathogenic/Likely Pathogenic (≥5 Variants)
Show/Hide Unknown Diseases (3)
Unknown / Other Associations ClinVar entries with uncertain/conflicting evidence, and associations from other databases (OMIM, Orphanet, GWAS, etc.) where the gene is not established as causal.
Phenotype Name Clinical Significance Source Evidence Score
alpha, alpha-Trehalase deficiency Uncertain significance; Conflicting classifications of pathogenicity ClinVar
★★★★★
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
TREH-related disorder Uncertain significance; Likely benign; Benign ClinVar
★★★★★
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
TREHALASE DEFICIENCY — CTD, HPO, Orphanet
CTD, HPO, Orphanet
CTD, HPO, Orphanet
★★★★★
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
Show/Hide Text Mining Associations (34)
Associations from Text Mining Disease associations identified through text mining
Disease Name Disease (Merged) Source PMID Relationship Type Evidence Score
Adult Medulloblastoma Medulloblastoma BEFREE 24871706, 25785590, 28167297
★★★★★
★☆☆☆☆
Found in Text Mining only
Ataxia, Spinocerebellar Spinocerebellar Ataxia BEFREE 26295831
★★★★★
★☆☆☆☆
Found in Text Mining only
Carcinoma of lung Lung carcinoma BEFREE 16437213
★★★★★
★☆☆☆☆
Found in Text Mining only
Cartilage Diseases Cartilage disease Pubtator 27701424 Associate
★★★★★
★☆☆☆☆
Found in Text Mining only
Childhood Medulloblastoma Medulloblastoma BEFREE 24871706, 25785590, 28167297
★★★★★
★☆☆☆☆
Found in Text Mining only
Congenital chromosomal disease Congenital Chromosomal Disease BEFREE 1980862
★★★★★
★☆☆☆☆
Found in Text Mining only
Diabetes Diabetes BEFREE 23468175, 24625756, 31838076
★★★★★
★☆☆☆☆
Found in Text Mining only
Diabetes Mellitus Diabetes Mellitus BEFREE 23468175, 24625756, 2619709, 31838076
★★★★★
★☆☆☆☆
Found in Text Mining only
Diabetes Mellitus Diabetes mellitus Pubtator 24625756 Associate
★★★★★
★☆☆☆☆
Found in Text Mining only
Diabetes Mellitus Type 2 Diabetes mellitus, type 2 Pubtator 23468175 Associate
★★★★★
★☆☆☆☆
Found in Text Mining only