Gene Gene information from NCBI Gene database.
Entrez ID 10907
Gene name Thioredoxin like 4A
Gene symbol TXNL4A
Synonyms (NCBI Gene)
BMKSDIB1DIM1SNRNP15TXNL4U5-15kD
Chromosome 18
Chromosome location 18q23
Summary The protein encoded by this gene is a member of the U5 small ribonucleoprotein particle (snRNP), and is involved in pre-mRNA splicing. This protein contains a thioredoxin-like fold and it is expected to interact with multiple proteins. Protein-protein int
SNPs SNP information provided by dbSNP.
7
SNP ID Visualize variation Clinical significance Consequence
rs535089924 CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATG>-,CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATG,CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATG Pathogenic Intron variant, upstream transcript variant, genic upstream transcript variant
rs727502793 C>A,T Pathogenic Non coding transcript variant, stop gained, coding sequence variant, missense variant
rs727502794 G>A Pathogenic Stop gained, coding sequence variant, non coding transcript variant, intron variant, 5 prime UTR variant
rs727502795 A>- Pathogenic Coding sequence variant, non coding transcript variant, intron variant, splice donor variant, frameshift variant, 5 prime UTR variant
rs786205699 CGCGCTAGCGCCGTGCGTGCTGACGGCATGTGCG>- Pathogenic Genic upstream transcript variant, intron variant, upstream transcript variant
miRNA miRNA information provided by mirtarbase database.
60
miRTarBase ID miRNA Experiments Reference
MIRT052139 hsa-let-7b-5p CLASH 23622248
MIRT050419 hsa-miR-23a-3p CLASH 23622248
MIRT041224 hsa-miR-193b-3p CLASH 23622248
MIRT036005 hsa-miR-1301-3p CLASH 23622248
MIRT712648 hsa-miR-6752-3p HITS-CLIP 19536157
Gene ontology (GO) Gene Ontology (GO) annotations describing the biological processes, molecular functions, and cellular components associated with a gene.
25
GO ID Ontology Definition Evidence Reference
GO:0000245 Process Spliceosomal complex assembly TAS 10610776
GO:0000375 Process RNA splicing, via transesterification reactions TAS 10610776
GO:0000398 Process MRNA splicing, via spliceosome IDA 28781166
GO:0000398 Process MRNA splicing, via spliceosome IEA
GO:0000398 Process MRNA splicing, via spliceosome NAS 30975767
Other IDs Other IDs provides unique identifiers for this gene in OMIM, HGNC, and Ensembl databases.
MIM HGNC e!Ensembl
611595 30551 ENSG00000141759
Protein Protein information from UniProt database.
UniProt ID Unique identifier for the protein in the UniProt database. Click to view detailed protein information.
P83876
Protein name Thioredoxin-like protein 4A (DIM1 protein homolog) (Spliceosomal U5 snRNP-specific 15 kDa protein) (Thioredoxin-like U5 snRNP protein U5-15kD)
Protein function Plays a role in pre-mRNA splicing as component of the U5 snRNP and U4/U6-U5 tri-snRNP complexes that are involved in spliceosome assembly, and as component of the precatalytic spliceosome (spliceosome B complex). {ECO:0000269|PubMed:28781166, EC
PDB 1PQN , 1QGV , 1SYX , 3JCR , 4BWQ , 4BWS , 4CDO , 5O9Z , 6AH0 , 6AHD , 6QW6 , 6QX9 , 8H6E , 8H6J , 8H6K , 8H6L , 8Q7N , 8QO9 , 8QOZ , 8QP8 , 8QP9 , 8QPA , 8QPB , 8QPE , 8QPK , 8QXD , 8QZS , 8R08 , 8R09 , 8R0A , 8R0B , 8RM5
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF02966 DIM1 4 136 Mitosis protein DIM1 Domain
Sequence
Sequence length 142
Interactions View interactions
Pathways Pathway information has different metabolic/signaling pathways associated with genes.
  KEGG  Reactome
  Spliceosome   mRNA Splicing - Major Pathway
mRNA Splicing - Minor Pathway
Associated diseases Disease associations from ClinVar (causal & non-causal) and other databases (OMIM, Orphanet, GWAS, etc.).
6
Evidence Score: ★☆☆☆☆  Gene-disease association found in Text Mining only ★★☆☆☆  Found in Text Mining and Unknown/Other Associations ★★★☆☆  Reported in Unknown/Other Associations across ≥2 Sources ★★★★☆  ClinVar: Pathogenic/Likely Pathogenic (<5 Variants) ★★★★★  ClinVar: Pathogenic/Likely Pathogenic (≥5 Variants)
Causal Diseases associated with Pathogenic or Likely Pathogenic variants in ClinVar
Phenotype Name Clinical Significance dbSNP ID RCV Accession Evidence Score
Choanal atresia-hearing loss-cardiac defects-craniofacial dysmorphism syndrome Likely pathogenic; Pathogenic rs1568360069, rs2145089648, rs2145048234, rs535089924, rs727502793, rs727502794, rs727502795, rs786205699, rs1555719172 RCV002226967
RCV002273877
RCV002273878
RCV000149583
RCV000149584
View all (4 more)
★★★★★
ClinVar: Pathogenic / Likely Pathogenic (≥5 Variants)
TXNL4A-related disorder Likely pathogenic; Pathogenic rs727502793, rs786205699 RCV003422037
RCV003407632
★★★★☆
ClinVar: Pathogenic / Likely Pathogenic (<5 Variants)
Unknown / Other Associations ClinVar entries with uncertain/conflicting evidence, and associations from other databases (OMIM, Orphanet, GWAS, etc.) where the gene is not established as causal.
Phenotype Name Clinical Significance Source Evidence Score
BURN-MCKEOWN SYNDROME CTD, Disgenet, HPO, Orphanet
CTD, Disgenet, HPO, Orphanet
CTD, Disgenet, HPO, Orphanet
CTD, Disgenet, HPO, Orphanet
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
Lung cancer Benign ClinVar
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
Malignant lymphoma, large B-cell, diffuse Benign ClinVar
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
Uterine carcinosarcoma Benign ClinVar
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
Associations from Text Mining Disease associations identified through text mining
Disease Name Disease (Merged) Source PMID Relationship Type Evidence Score
2-3 toe syndactyly Syndactyly Of The Toes HPO_DG
★☆☆☆☆
Found in Text Mining only
Acrofacial Dysostosis Acrofacial Dysostosis BEFREE 25865758
★☆☆☆☆
Found in Text Mining only
Atrial Septal Defects Atrial Septal Defect HPO_DG
★☆☆☆☆
Found in Text Mining only
Bilateral choanal atresia/stenosis Choanal Atresia HPO_DG
★☆☆☆☆
Found in Text Mining only
Blepharophimosis Blepharophimosis HPO_DG
★☆☆☆☆
Found in Text Mining only
Burn-Mckeown syndrome Burn-Mckeown Syndrome BEFREE 25434003, 25865758, 28905882
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
Burn-Mckeown syndrome Burn-Mckeown Syndrome ORPHANET_DG 25434003
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
Burn-Mckeown syndrome Burn-Mckeown Syndrome CLINVAR_DG 25434003
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
Burn-Mckeown syndrome Burn-Mckeown Syndrome GENOMICS_ENGLAND_DG 25434003
★★☆☆☆
Found in Text Mining + Unknown/Other Associations
Burn-McKeown syndrome Burn-Mckeown Syndrome Orphanet
★★☆☆☆
Found in Text Mining + Unknown/Other Associations