Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
9663 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Lipin 2 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
LPIN2 |
SynonymsGene synonyms aliases
|
CRMO1, MJDS |
ChromosomeChromosome number
|
18 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
18p11.31 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
Mouse studies suggest that this gene functions during normal adipose tissue development and may play a role in human triglyceride metabolism. This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hy |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs17555442 |
G>A |
Conflicting-interpretations-of-pathogenicity, benign |
Genic downstream transcript variant, coding sequence variant, synonymous variant |
rs80338806 |
AT>- |
Pathogenic |
Coding sequence variant, non coding transcript variant, frameshift variant |
rs80338807 |
G>A |
Pathogenic |
Genic downstream transcript variant, coding sequence variant, missense variant |
rs80338808 |
C>G |
Pathogenic |
Splice donor variant, genic downstream transcript variant |
rs104895500 |
G>A |
Conflicting-interpretations-of-pathogenicity, uncertain-significance |
Coding sequence variant, non coding transcript variant, missense variant |
rs116643915 |
G>A |
Conflicting-interpretations-of-pathogenicity |
Intron variant, genic upstream transcript variant, 5 prime UTR variant |
rs140249737 |
A>G |
Likely-benign, conflicting-interpretations-of-pathogenicity |
Synonymous variant, coding sequence variant, genic downstream transcript variant |
rs150022314 |
A>C,G |
Benign-likely-benign, likely-benign, conflicting-interpretations-of-pathogenicity |
Missense variant, non coding transcript variant, coding sequence variant |
rs200648652 |
C>T |
Conflicting-interpretations-of-pathogenicity, uncertain-significance |
Missense variant, coding sequence variant, genic downstream transcript variant |
rs201325845 |
C>T |
Conflicting-interpretations-of-pathogenicity |
Missense variant, coding sequence variant, non coding transcript variant |
rs318240736 |
AG>- |
Pathogenic |
Frameshift variant, coding sequence variant, non coding transcript variant |
rs746626720 |
A>-,AA,AAAAAAAA |
Conflicting-interpretations-of-pathogenicity, benign-likely-benign |
Intron variant |
rs750126005 |
G>A |
Pathogenic |
Non coding transcript variant, stop gained, coding sequence variant |
rs756933588 |
C>T |
Likely-pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs876660982 |
->ACAC |
Pathogenic |
Coding sequence variant, non coding transcript variant, frameshift variant |
rs916009547 |
G>A |
Pathogenic |
Coding sequence variant, non coding transcript variant, stop gained |
rs1175109245 |
G>A,T |
Pathogenic |
Intron variant, missense variant, stop gained, coding sequence variant |
rs1598522408 |
GCTGTTCCTTGCCACCCACCTGAAGGATTGAGCTTACTTGG>- |
Likely-pathogenic |
Coding sequence variant, splice donor variant, genic downstream transcript variant, intron variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
Q92539 |
Protein name |
Phosphatidate phosphatase LPIN2 (EC 3.1.3.4) (Lipin-2) |
Protein function |
Acts as a magnesium-dependent phosphatidate phosphatase enzyme which catalyzes the conversion of phosphatidic acid to diacylglycerol during triglyceride, phosphatidylcholine and phosphatidylethanolamine biosynthesis in the endoplasmic reticulum |
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF04571 |
Lipin_N |
1 → 107 |
lipin, N-terminal conserved region |
Family |
PF16876 |
Lipin_mid |
469 → 561 |
Lipin/Ned1/Smp2 multi-domain protein middle domain |
Family |
PF08235 |
LNS2 |
637 → 862 |
LNS2 (Lipin/Ned1/Smp2) |
Domain |
|
Sequence |
|
Sequence length |
896 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Anemia |
Iron-Refractory Iron Deficiency Anemia, Microcytic hypochromic anemia (disorder) |
rs118204044, rs118204045, rs118204046, rs121918330, rs869320719, rs869312029, rs121918332, rs869320724, rs767094129, rs786205058, rs786205059, rs137853119, rs137853120, rs137853121, rs1384933966, rs137853122, rs137853123, rs786205060, rs267607121, rs121908584, rs80338697, rs80338699, rs120074166, rs120074167, rs1050828, rs74575103, rs137852314, rs5030868, rs137852316, rs137852317, rs137852318, rs137852319, rs137852320, rs137852321, rs137852322, rs137852323, rs137852324, rs72554665, rs387906468, rs5030872, rs137852326, rs137852333, rs137852327, rs137852328, rs137852329, rs137852330, rs137852331, rs137852332, rs137852334, rs137852335, rs137852336, rs137852339, rs76645461, rs137852340, rs137852341, rs78478128, rs137852343, rs137852344, rs137852345, rs587776730, rs137852346, rs137852347, rs137852349, rs2070404412, rs2070350038, rs2070350009, rs137852303, rs137852304, rs33946267, rs34378160, rs33933298, rs11549407, rs35724775, rs34598529, rs41469945, rs267607201, rs80338694, rs80338696, rs387907018, rs398123546, rs78365220, rs587777100, rs587777101, rs483352840, rs869312752, rs765487627, rs1557229599, rs1557230040, rs1555524842, rs782090947, rs1358275550, rs1557229736, rs1557230573, rs1556323334, rs1233124208, rs1293528130, rs146864395, rs1595503440, rs1603411214, rs137852325, rs1575247302, rs1603411177, rs1336651679, rs782322505 |
15994876, 23087183 |
Asthma |
Asthma |
rs324981, rs121912630, rs150116809, rs4950928, rs708494, rs1581842283 |
23517042 |
Autoinflammatory disease |
Autoinflammatory disorder, Hereditary Autoinflammatory Diseases |
rs777759523, rs121434352, rs28940578, rs28940580, rs121908146, rs121908148, rs121908150, rs80338807, rs121908679, rs104895319, rs104894176, rs28933973, rs28933376, rs137854447, rs61736587, rs148755083, rs104895093, rs104895311, rs104895364, rs104895352, rs104895271, rs104895238, rs151344629, rs180177431, rs376785840, rs587777241, rs77563738, rs202134424, rs864321625, rs864321682, rs864321626, rs864321684, rs864321685, rs869312838, rs869312953, rs766657895, rs140148806, rs753966933, rs764196809, rs200956636, rs147035858, rs1274685768, rs1600700389, rs1776278098, rs754904956, rs1760720617, rs1760720924 |
27860302, 17330256 |
Congenital dyserythropoietic anemia |
Congenital dyserythropoietic anemia |
rs121918221, rs121918222, rs121918224, rs121918225, rs121918226, rs80338697, rs80338699, rs120074166, rs120074167, rs120074168, rs120074169, rs80338694, rs80338696, rs398124225, rs398124226, rs199939108, rs727504145, rs1555788144, rs138334226, rs1403456625, rs1600244935, rs140334403, rs1600288964 |
23087183, 15994876 |
Dermatitis |
Inflammatory dermatosis |
rs61816761, rs150597413, rs138726443, rs201356558, rs149484917, rs372754256, rs747301529, rs567795279, rs745915174 |
|
Majeed syndrome |
Majeed syndrome |
rs80338807, rs80338806, rs80338808, rs876660982, rs916009547, rs750126005, rs1598522408, rs2077113045, rs2077209051 |
23087183, 27860302, 29912021, 15994876, 17330256 |
Osteomyelitis |
Osteomyelitis |
rs11125529, rs10936599, rs7675998, rs398652, rs755017 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Acne |
Acne |
|
|
Avellino corneal dystrophy |
Avellino corneal dystrophy |
|
15994876, 23087183 |
Congenital hypoplastic anemia |
Congenital hypoplastic anemia |
|
|
Malabsorption syndrome |
Malabsorption Syndrome |
|
|
Osteosclerosis |
Osteosclerosis |
|
|
Renal glomerular disease |
Renal glomerular disease |
|
|
Synovitis |
Synovitis |
|
|
|
|
|