GediPNet logo

H6PD (hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase)

Gene
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
9563
Gene nameGene Name - the full gene name approved by the HGNC.
Hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
H6PD
SynonymsGene synonyms aliases
CORTRD1, G6PDH, GDH, H6PDH
ChromosomeChromosome number
1
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
1p36.22
SummarySummary of gene provided in NCBI Entrez Gene.
There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific
SNPsSNP information provided by dbSNP.
SNP ID Visualize variation Clinical significance Consequence
rs387907167 G>A Pathogenic Coding sequence variant, missense variant
rs398122816 G>A Pathogenic Synonymous variant, coding sequence variant, intron variant
rs398122817 C>G Pathogenic Coding sequence variant, 5 prime UTR variant, stop gained
rs398122818 C>- Pathogenic Coding sequence variant, 5 prime UTR variant, frameshift variant
rs606231222 ->ACAGGTGGTTGACCTGTGGCCGGGTCTGA Pathogenic Stop gained, coding sequence variant, inframe indel
miRNAmiRNA information provided by mirtarbase database.
miRTarBase ID miRNA Experiments Reference
MIRT018427 hsa-miR-335-5p Microarray 18185580
MIRT022903 hsa-miR-124-3p Microarray 18668037
MIRT707244 hsa-miR-6732-3p HITS-CLIP 21572407
MIRT707243 hsa-miR-10a-5p HITS-CLIP 21572407
MIRT707242 hsa-miR-10b-5p HITS-CLIP 21572407
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
GO ID Ontology Definition Evidence Reference
GO:0004345 Function Glucose-6-phosphate dehydrogenase activity IDA 18628520, 23132696
GO:0005739 Component Mitochondrion IEA
GO:0005788 Component Endoplasmic reticulum lumen IDA 18628520
GO:0006006 Process Glucose metabolic process IEA
GO:0009051 Process Pentose-phosphate shunt, oxidative branch IMP 18628520, 23132696
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
MIM
HGNC
e!Ensembl
Protein
UniProt ID O95479
Protein name GDH/6PGL endoplasmic bifunctional protein [Includes: Hexose-6-phosphate dehydrogenase (Glucose 1-dehydrogenase) (GDH) (EC 1.1.1.47) (Glucose-6-phosphate dehydrogenase) (EC 1.1.1.363); 6-phosphogluconolactonase (6PGL) (EC 3.1.1.31)]
Protein function Bifunctional enzyme localized in the lumen of the endoplasmic reticulum that catalyzes the first two steps of the oxidative branch of the pentose phosphate pathway/shunt, an alternative to glycolysis and a major source of reducing power and meta
PDB 8EM2
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF00479 G6PD_N
29 213
Glucose-6-phosphate dehydrogenase, NAD binding domain
Domain
PF02781 G6PD_C
215 515
Glucose-6-phosphate dehydrogenase, C-terminal domain
Domain
PF01182 Glucosamine_iso
558 782
Glucosamine-6-phosphate isomerases/6-phosphogluconolactonase
Domain
Sequence
Sequence length 791
Interactions View interactions
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
 
KEGG
 
  Pentose phosphate pathway
Metabolic pathways
Carbon metabolism
 
Associated diseases
Causal
Disease name Disease term dbSNP ID References
Breast cancer Malignant neoplasm of breast rs587776547, rs1137887, rs137853007, rs587776650, rs80359351, rs80359714, rs121917783, rs104886456, rs121964878, rs80359874, rs80357868, rs80357508, rs387906843, rs80357569, rs80358158, rs80357524, rs80357115, rs80357945, rs80357729, rs80357609, rs80357259, rs80357981, rs80358063, rs80357389, rs80356862, rs80359876, rs80357580, rs80358053, rs80358089, rs80187739, rs397507241, rs80358069, rs80357590, rs80357284, rs80357941, rs80359261, rs80359272, rs80359276, rs276174813, rs80358474, rs80359316, rs1555282969, rs80359388, rs80359499, rs80359505, rs80359520, rs80359526, rs80359533, rs56253082, rs80358824, rs80359554, rs80359636, rs80359651, rs80359659, rs80359011, rs80359012, rs80359013, rs80359718, rs397507410, rs81002812, rs80359730, rs80359152, rs80359159, rs397507419, rs28897759, rs80359211, rs80359775, rs397514577, rs397507584, rs80358435, rs80358456, rs80359340, rs80359343, rs80359365, rs80358579, rs397507670, rs80358593, rs80359406, rs80359444, rs80359454, rs276174853, rs276174854, rs80359483, rs80359537, rs80358815, rs80358843, rs80359558, rs80359560, rs80359594, rs80358893, rs28897743, rs397507900, rs397507906, rs397507918, rs80358971, rs80358981, rs397507941, rs80359030, rs80359035, rs41293511, rs397507396, rs81002806, rs80359112, rs397508006, rs81002893, rs45580035, rs80359760, rs397508051, rs80359772, rs4987049, rs80359777, rs80357770, rs397508867, rs62625303, rs397508874, rs80357506, rs80357287, rs273898674, rs80358042, rs80358083, rs80357058, rs41286296, rs80357960, rs80356945, rs80357223, rs386134270, rs80358116, rs80357856, rs80357424, rs397509050, rs80357485, rs80357966, rs397509067, rs80357310, rs80356866, rs80357260, rs80357437, rs80358023, rs80358086, rs80357133, rs80356993, rs80357997, rs80357239, rs80357227, rs397509243, rs80356969, rs80356959, rs63750617, rs63751319, rs587779315, rs200640585, rs398122546, rs80357543, rs398122687, rs80359328, rs398122779, rs398122783, rs62517194, rs80358029, rs515726060, rs180177103, rs180177111, rs180177133, rs587776527, rs180177135, rs180177136, rs515726117, rs587779813, rs587779909, rs587780024, rs587780100, rs28909982, rs121908698, rs180177100, rs587780210, rs587780240, rs587780639, rs587781269, rs587781353, rs587781471, rs587781658, rs587781697, rs587781730, rs587781894, rs587781948, rs587782005, rs587782011, rs200928781, rs587781558, rs370228071, rs587782245, rs587782401, rs180177110, rs587782504, rs72552322, rs587782531, rs587782620, rs587782680, rs587782774, rs587782818, rs730881411, rs730881389, rs564652222, rs397507768, rs587776419, rs730881868, rs730881940, rs56383036, rs758972589, rs201089102, rs730881348, rs786202608, rs786201886, rs786203318, rs786203775, rs786203714, rs786202033, rs750621215, rs786203884, rs786203650, rs772821016, rs863224521, rs864622223, rs864622655, rs375699023, rs876659572, rs768362387, rs876659535, rs876658957, rs483353072, rs876659435, rs267608041, rs876661113, rs730881369, rs878853535, rs772228129, rs878855122, rs760551339, rs80359596, rs397509222, rs886039630, rs886039683, rs886040828, rs587781799, rs886040374, rs886040649, rs397507967, rs878854957, rs886040043, rs1057517589, rs1060502769, rs866380588, rs863224765, rs1064793243, rs747563556, rs1555074976, rs1064795885, rs753961188, rs1064794708, rs869312772, rs1064793887, rs1131690820, rs1135401928, rs1135401868, rs1135401859, rs1553370324, rs397507630, rs1555283160, rs1555283251, rs1555283262, rs1555283361, rs1555286298, rs1555288462, rs886040950, rs1555289566, rs776323117, rs80357123, rs1555579627, rs1555580697, rs80358054, rs1555593302, rs1328985852, rs763470424, rs1555139694, rs878854697, rs1555461217, rs1555461765, rs774684620, rs766416564, rs1554558613, rs1305740166, rs1555461460, rs1555461407, rs1555461586, rs1555567202, rs1555607022, rs1555069815, rs1442299125, rs1474786480, rs1555084947, rs1555457867, rs141087784, rs1482641121, rs1564830522, rs1565469955, rs1565503137, rs864622613, rs755263466, rs757679199, rs1593903166, rs1597801649, rs1603293306, rs879253880, rs80358754, rs1597062038, rs45494092, rs1603275367, rs887358871, rs1597091518, rs1966967065, rs1064793049, rs2082872908, rs2085078278, rs2072475243 29295867
Breast carcinoma Breast Carcinoma rs80359671, rs11540652, rs28934575, rs28897672, rs137886232, rs193922376, rs80357783, rs80359306, rs80359405, rs80359507, rs80359598, rs80358429, rs397507683, rs397515636, rs80359451, rs397507859, rs80359709, rs80359742, rs80359205, rs80357627, rs80357004, rs80357571, rs80357767, rs80357653, rs80358086, rs80357608, rs28897696, rs41293465, rs146650273, rs63751017, rs63750617, rs63750726, rs63750199, rs63749848, rs398122618, rs398122653, rs397509211, rs80357791, rs121912666, rs587778541, rs121908698, rs536907995, rs587781302, rs140342925, rs587781506, rs587782652, rs587782849, rs587783057, rs10520699, rs11852999, rs139770721, rs374950566, rs786202800, rs863224451, rs377153250, rs747727055, rs876658804, rs780001540, rs760815829, rs878854926, rs775248597, rs886040658, rs886040192, rs786203523, rs886040319, rs397508006, rs587782011, rs1060502772, rs1555461727, rs1553333072, rs1114167702, rs1257401983, rs886040950, rs1060502759, rs774684620, rs142947311, rs1555580883, rs748513310, rs376170600, rs863224499, rs1593909229, rs748453607, rs1294578913, rs1574737047, rs1593909960, rs2081922847, rs2082559544, rs2053694038 29295867
Cortisone reductase deficiency Cortisone reductase deficiency, CORTISONE REDUCTASE DEFICIENCY 1 rs606231222, rs398122816, rs387907167, rs398122817, rs398122818, rs387907168, rs756817759 18628520, 17974005, 18628520, 12858176, 23132696
Hyperandrogenism Hyperandrogenism due to cortisone reductase deficiency rs151344506
Unknown
Disease name Disease term dbSNP ID References
Acne Acne
Mammary neoplasms Mammary Neoplasms, Human, Mammary Neoplasms 29295867

| © 2021, Biomedical Informatics Centre, NIRRH |
ICMR-National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400012
Tel: +91-22-24192104, Fax No: +91-22-24139412