ECEL1 (endothelin converting enzyme like 1)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
9427 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Endothelin converting enzyme like 1 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
ECEL1 |
SynonymsGene synonyms aliases
|
DA5D, DINE, ECEX, XCE |
ChromosomeChromosome number
|
2 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
2q37.1 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene encodes a member of the M13 family of endopeptidases. Members of this family are zinc-containing type II integral-membrane proteins that are important regulators of neuropeptide and peptide hormone activity. Mutations in this gene are associated |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs117012322 |
C>A,T |
Conflicting-interpretations-of-pathogenicity, benign |
Coding sequence variant, missense variant |
rs149459910 |
C>T |
Pathogenic |
Coding sequence variant, stop gained |
rs370167241 |
G>A |
Pathogenic |
Stop gained, coding sequence variant |
rs532757890 |
G>A |
Pathogenic, likely-pathogenic |
Missense variant, coding sequence variant |
rs587776917 |
->T |
Pathogenic |
Stop gained, coding sequence variant |
rs587776918 |
TCCAGGTTGGCG>- |
Pathogenic |
Inframe deletion, coding sequence variant |
rs587776919 |
G>A,T |
Pathogenic |
Missense variant, coding sequence variant |
rs587776920 |
T>A |
Pathogenic |
Intron variant |
rs587776921 |
C>T |
Pathogenic |
Missense variant, coding sequence variant |
rs587777129 |
A>G |
Pathogenic |
Missense variant, coding sequence variant |
rs587777130 |
G>C |
Pathogenic |
Stop gained, coding sequence variant |
rs587777131 |
C>A,T |
Pathogenic |
Splice donor variant, intron variant |
rs606231471 |
C>A,T |
Pathogenic |
Missense variant, coding sequence variant |
rs762979130 |
A>G,T |
Pathogenic |
Splice donor variant |
rs764471983 |
A>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
rs765430577 |
C>A,T |
Pathogenic |
Coding sequence variant, missense variant |
rs767987856 |
GCCAGGCCCACCCCCGGGCCGCGCC>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs878853117 |
T>C |
Pathogenic |
Coding sequence variant, missense variant |
rs878853118 |
CCCAT>AGC |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1057518181 |
C>A,G |
Pathogenic |
Missense variant, coding sequence variant, stop gained |
rs1190799930 |
G>A |
Pathogenic |
Stop gained, coding sequence variant |
rs1229171141 |
G>A,C |
Likely-pathogenic |
Intron variant |
rs1341894581 |
ACCGGGCCCCGGTGGCGCTGCGCGCAGCGCCCAACGGGAAGCCCGG>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1356994386 |
T>A,C |
Likely-pathogenic |
Initiator codon variant, missense variant |
rs1553566820 |
C>T |
Likely-pathogenic |
Intron variant |
rs1553567402 |
->CAC |
Likely-pathogenic |
Coding sequence variant, inframe insertion |
rs1553567411 |
C>A |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1553567937 |
C>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1575076514 |
C>T |
Pathogenic |
Splice donor variant |
rs1575079032 |
C>- |
Pathogenic |
Frameshift variant, coding sequence variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
O95672 |
Protein name |
Endothelin-converting enzyme-like 1 (EC 3.4.24.-) (Xce protein) |
Protein function |
May contribute to the degradation of peptide hormones and be involved in the inactivation of neuronal peptides. |
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF05649 |
Peptidase_M13_N |
122 → 513 |
Peptidase family M13 |
Family |
PF01431 |
Peptidase_M13 |
571 → 774 |
Peptidase family M13 |
Family |
|
Sequence |
|
Sequence length |
775 |
Interactions |
View interactions |
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Arthrogryposis multiplex congenita |
Arthrogryposis |
rs1586285494, rs80358233, rs137853305, rs1559154278, rs398124167, rs398124172, rs587780399, rs786204576, rs786204430, rs769345284, rs749355583, rs793888524, rs793888525, rs878854368, rs555445835, rs758105619, rs886041851, rs794727136, rs755239192, rs760715690, rs773952935, rs112610938, rs1057516676, rs1057516996, rs780022652, rs1057517399, rs1057517360, rs1057518353, rs1057517977, rs1064796311, rs779232987, rs775997446, rs1064797093, rs1064797094, rs1064797095, rs755500591, rs754272530, rs758247804, rs200731870, rs747179265, rs1553740233, rs776569219, rs375628303, rs775631800, rs781667543, rs1553548666, rs928945364, rs763364977, rs1458048713, rs1553883480, rs1472403020, rs1336053002, rs202048855, rs1197561990, rs755531536, rs1554112524, rs762133567, rs1553555882, rs934111355, rs1255744452, rs1366269616, rs1555734932, rs1553548207, rs752582527, rs1257495033, rs113525641, rs755863625, rs374929094, rs539819851, rs1366853918, rs1218073575, rs1553537512, rs1553552384, rs747564597, rs776059611, rs756726488, rs1357811155, rs1553939600, rs772009599, rs1255445731, rs1011425121, rs1553561697, rs1553551748, rs1553552413, rs760935667, rs1553603400, rs1302373559, rs1389892619, rs1553710982, rs757157808, rs1180339426, rs761964375, rs1235589246, rs1443738549, rs1553934586, rs1553934597, rs1553603437, rs749452641, rs1553904694, rs754369875, rs112517981, rs774495973, rs1428597732, rs746999970, rs113091511, rs1553603958, rs1553469502, rs770797137, rs1553608621, rs1159756073, rs776167256, rs778593702, rs1553601066, rs1553689774, rs760768475, rs1559296376, rs201636991, rs1559039815, rs748922882, rs772366030, rs1207534366, rs1259297878, rs762780413, rs1559360386, rs1559940778, rs760200697, rs1344099907, rs750900690, rs1559168230, rs746177326, rs761067911, rs1323364980, rs537560378, rs1319778592, rs1340063197, rs1577833924, rs750585238, rs1600470099, rs1575714905, rs1576203853, rs779909544, rs760124743, rs2096362304, rs1212374733, rs1490309743, rs767709270, rs1374971806, rs2096491549, rs2097886912, rs2099021112, rs2097758221, rs1474341248, rs925947627 |
|
Brachydactyly |
Brachydactyly |
rs121908949, rs28937580, rs121909082, rs104894122, rs863223289, rs863223290, rs104894121, rs1587657302, rs863223292, rs74315386, rs74315387, rs28936397, rs753691079, rs121909348, rs121917852, rs121917853, rs121917854, rs121917855, rs121917859, rs121917861, rs267606873, rs267606872, rs267606985, rs267606986, rs267606987, rs267606988, rs28933082, rs397514519, rs869025613, rs869025614, rs886039878, rs1553540620, rs1057518333, rs1948841937, rs1948868228, rs1948842030, rs1948842142 |
|
Distal arthrogryposis |
Distal arthrogryposis type 5D |
rs121434638, rs104894127, rs104894129, rs137853305, rs137853306, rs199476153, rs199476147, rs121913619, rs879255230, rs387906657, rs387906658, rs199474721, rs587776917, rs587776918, rs587776919, rs587776920, rs587777129, rs587777130, rs587777131, rs199476146, rs606231471, rs370167241, rs765430577, rs878853117, rs878853118, rs1555621138, rs149459910, rs1553566820, rs1553567411, rs1553567937, rs1341894581, rs201987709, rs1554658995, rs1554289078, rs762979130, rs1554659746, rs1555242493, rs1555769818, rs1567973091, rs1563929039, rs1563929143, rs1350968647, rs1356994386, rs1229171141, rs1567559027, rs1563929383, rs113612402, rs1465836003, rs1597490381, rs1190799930, rs767987856, rs1587956195, rs1281970248, rs1575076514, rs1597482824, rs1825151618 |
23236030, 23261301, 30131190, 23808592, 23829171 |
Multiple congenital anomalies |
Multiple congenital anomalies |
rs1057517732 |
24782201, 25708584, 23261301, 23236030, 25099528 |
Scoliosis |
Scoliosis, unspecified |
rs1057518828, rs147296805, rs758163506, rs1555613564, rs1596852902, rs1596853067, rs1596853085 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Astigmatism |
Astigmatism |
|
|
Congenital camptodactyly |
Congenital Camptodactyly |
|
|
Dwarfism |
Dwarfism |
|
|
Dysmorphic features |
Dysmorphic features |
|
25099528, 23261301, 25708584, 24782201, 23236030 |
Elbow flexion contracture |
Flexion contracture - elbow |
|
|
High palate |
Byzanthine arch palate |
|
|
Micrognathism |
Micrognathism |
|
|
Ptosis |
Blepharoptosis, Ptosis |
rs139920573 |
|
|
|
|