GediPNet logo

PIGS (phosphatidylinositol glycan anchor biosynthesis class S)

Gene
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
94005
Gene nameGene Name - the full gene name approved by the HGNC.
Phosphatidylinositol glycan anchor biosynthesis class S
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
PIGS
SynonymsGene synonyms aliases
DEE95, GPIBD18, PIG-S
ChromosomeChromosome number
17
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
17q11.2
SummarySummary of gene provided in NCBI Entrez Gene.
This gene encodes a protein that is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes an essential component of
SNPsSNP information provided by dbSNP.
SNP ID Visualize variation Clinical significance Consequence
rs1263517814 C>T Likely-pathogenic Coding sequence variant, stop gained
rs1426262136 T>C Likely-pathogenic Missense variant, coding sequence variant
rs1567614073 TTGCCCAGAAGCTGCGCCAGGGAGGTAAGGGTGGTGG>AGCAACC Pathogenic Coding sequence variant, inframe indel
rs1567616570 C>G Pathogenic Splice donor variant
rs1567618413 A>G Likely-pathogenic Coding sequence variant, missense variant
miRNAmiRNA information provided by mirtarbase database.
miRTarBase ID miRNA Experiments Reference
MIRT023832 hsa-miR-1-3p Proteomics 18668040
MIRT051472 hsa-let-7e-5p CLASH 23622248
MIRT050805 hsa-miR-17-5p CLASH 23622248
MIRT049567 hsa-miR-92a-3p CLASH 23622248
MIRT043511 hsa-miR-331-3p CLASH 23622248
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
GO ID Ontology Definition Evidence Reference
GO:0005515 Function Protein binding IPI 11483512, 25416956, 32296183
GO:0005789 Component Endoplasmic reticulum membrane TAS
GO:0016020 Component Membrane HDA 19946888
GO:0016255 Process Attachment of GPI anchor to protein TAS 11483512
GO:0042765 Component GPI-anchor transamidase complex IDA 11483512, 12802054
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
MIM
HGNC
e!Ensembl
Protein
UniProt ID Q96S52
Protein name GPI-anchor transamidase component PIGS (Phosphatidylinositol-glycan biosynthesis class S protein)
Protein function Component of the glycosylphosphatidylinositol-anchor (GPI-anchor) transamidase (GPI-T) complex that catalyzes the formation of the linkage between a proprotein and a GPI-anchor and participates in GPI anchored protein biosynthesis. {ECO:0000269|
PDB 7W72 , 7WLD , 8IMX , 8IMY
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF10510 PIG-S
22 547
Phosphatidylinositol-glycan biosynthesis class S protein
Family
Sequence
Sequence length 555
Interactions View interactions
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
 
KEGG
 
Reactome
  Glycosylphosphatidylinositol (GPI)-anchor biosynthesis
Metabolic pathways
  Attachment of GPI anchor to uPAR
Associated diseases
Causal
Disease name Disease term dbSNP ID References
Arthrogryposis multiplex congenita Arthrogryposis rs1586285494, rs80358233, rs137853305, rs1559154278, rs398124167, rs398124172, rs587780399, rs786204576, rs786204430, rs769345284, rs749355583, rs793888524, rs793888525, rs878854368, rs555445835, rs758105619, rs886041851, rs794727136, rs755239192, rs760715690, rs773952935, rs112610938, rs1057516676, rs1057516996, rs780022652, rs1057517399, rs1057517360, rs1057518353, rs1057517977, rs1064796311, rs779232987, rs775997446, rs1064797093, rs1064797094, rs1064797095, rs755500591, rs754272530, rs758247804, rs200731870, rs747179265, rs1553740233, rs776569219, rs375628303, rs775631800, rs781667543, rs1553548666, rs928945364, rs763364977, rs1458048713, rs1553883480, rs1472403020, rs1336053002, rs202048855, rs1197561990, rs755531536, rs1554112524, rs762133567, rs1553555882, rs934111355, rs1255744452, rs1366269616, rs1555734932, rs1553548207, rs752582527, rs1257495033, rs113525641, rs755863625, rs374929094, rs539819851, rs1366853918, rs1218073575, rs1553537512, rs1553552384, rs747564597, rs776059611, rs756726488, rs1357811155, rs1553939600, rs772009599, rs1255445731, rs1011425121, rs1553561697, rs1553551748, rs1553552413, rs760935667, rs1553603400, rs1302373559, rs1389892619, rs1553710982, rs757157808, rs1180339426, rs761964375, rs1235589246, rs1443738549, rs1553934586, rs1553934597, rs1553603437, rs749452641, rs1553904694, rs754369875, rs112517981, rs774495973, rs1428597732, rs746999970, rs113091511, rs1553603958, rs1553469502, rs770797137, rs1553608621, rs1159756073, rs776167256, rs778593702, rs1553601066, rs1553689774, rs760768475, rs1559296376, rs201636991, rs1559039815, rs748922882, rs772366030, rs1207534366, rs1259297878, rs762780413, rs1559360386, rs1559940778, rs760200697, rs1344099907, rs750900690, rs1559168230, rs746177326, rs761067911, rs1323364980, rs537560378, rs1319778592, rs1340063197, rs1577833924, rs750585238, rs1600470099, rs1575714905, rs1576203853, rs779909544, rs760124743, rs2096362304, rs1212374733, rs1490309743, rs767709270, rs1374971806, rs2096491549, rs2097886912, rs2099021112, rs2097758221, rs1474341248, rs925947627
Brachydactyly Brachydactyly rs121908949, rs28937580, rs121909082, rs104894122, rs863223289, rs863223290, rs104894121, rs1587657302, rs863223292, rs74315386, rs74315387, rs28936397, rs753691079, rs121909348, rs121917852, rs121917853, rs121917854, rs121917855, rs121917859, rs121917861, rs267606873, rs267606872, rs267606985, rs267606986, rs267606987, rs267606988, rs28933082, rs397514519, rs869025613, rs869025614, rs886039878, rs1553540620, rs1057518333, rs1948841937, rs1948868228, rs1948842030, rs1948842142
Breast cancer Malignant neoplasm of breast rs587776547, rs1137887, rs137853007, rs587776650, rs80359351, rs80359714, rs121917783, rs104886456, rs121964878, rs80359874, rs80357868, rs80357508, rs387906843, rs80357569, rs80358158, rs80357524, rs80357115, rs80357945, rs80357729, rs80357609, rs80357259, rs80357981, rs80358063, rs80357389, rs80356862, rs80359876, rs80357580, rs80358053, rs80358089, rs80187739, rs397507241, rs80358069, rs80357590, rs80357284, rs80357941, rs80359261, rs80359272, rs80359276, rs276174813, rs80358474, rs80359316, rs1555282969, rs80359388, rs80359499, rs80359505, rs80359520, rs80359526, rs80359533, rs56253082, rs80358824, rs80359554, rs80359636, rs80359651, rs80359659, rs80359011, rs80359012, rs80359013, rs80359718, rs397507410, rs81002812, rs80359730, rs80359152, rs80359159, rs397507419, rs28897759, rs80359211, rs80359775, rs397514577, rs397507584, rs80358435, rs80358456, rs80359340, rs80359343, rs80359365, rs80358579, rs397507670, rs80358593, rs80359406, rs80359444, rs80359454, rs276174853, rs276174854, rs80359483, rs80359537, rs80358815, rs80358843, rs80359558, rs80359560, rs80359594, rs80358893, rs28897743, rs397507900, rs397507906, rs397507918, rs80358971, rs80358981, rs397507941, rs80359030, rs80359035, rs41293511, rs397507396, rs81002806, rs80359112, rs397508006, rs81002893, rs45580035, rs80359760, rs397508051, rs80359772, rs4987049, rs80359777, rs80357770, rs397508867, rs62625303, rs397508874, rs80357506, rs80357287, rs273898674, rs80358042, rs80358083, rs80357058, rs41286296, rs80357960, rs80356945, rs80357223, rs386134270, rs80358116, rs80357856, rs80357424, rs397509050, rs80357485, rs80357966, rs397509067, rs80357310, rs80356866, rs80357260, rs80357437, rs80358023, rs80358086, rs80357133, rs80356993, rs80357997, rs80357239, rs80357227, rs397509243, rs80356969, rs80356959, rs63750617, rs63751319, rs587779315, rs200640585, rs398122546, rs80357543, rs398122687, rs80359328, rs398122779, rs398122783, rs62517194, rs80358029, rs515726060, rs180177103, rs180177111, rs180177133, rs587776527, rs180177135, rs180177136, rs515726117, rs587779813, rs587779909, rs587780024, rs587780100, rs28909982, rs121908698, rs180177100, rs587780210, rs587780240, rs587780639, rs587781269, rs587781353, rs587781471, rs587781658, rs587781697, rs587781730, rs587781894, rs587781948, rs587782005, rs587782011, rs200928781, rs587781558, rs370228071, rs587782245, rs587782401, rs180177110, rs587782504, rs72552322, rs587782531, rs587782620, rs587782680, rs587782774, rs587782818, rs730881411, rs730881389, rs564652222, rs397507768, rs587776419, rs730881868, rs730881940, rs56383036, rs758972589, rs201089102, rs730881348, rs786202608, rs786201886, rs786203318, rs786203775, rs786203714, rs786202033, rs750621215, rs786203884, rs786203650, rs772821016, rs863224521, rs864622223, rs864622655, rs375699023, rs876659572, rs768362387, rs876659535, rs876658957, rs483353072, rs876659435, rs267608041, rs876661113, rs730881369, rs878853535, rs772228129, rs878855122, rs760551339, rs80359596, rs397509222, rs886039630, rs886039683, rs886040828, rs587781799, rs886040374, rs886040649, rs397507967, rs878854957, rs886040043, rs1057517589, rs1060502769, rs866380588, rs863224765, rs1064793243, rs747563556, rs1555074976, rs1064795885, rs753961188, rs1064794708, rs869312772, rs1064793887, rs1131690820, rs1135401928, rs1135401868, rs1135401859, rs1553370324, rs397507630, rs1555283160, rs1555283251, rs1555283262, rs1555283361, rs1555286298, rs1555288462, rs886040950, rs1555289566, rs776323117, rs80357123, rs1555579627, rs1555580697, rs80358054, rs1555593302, rs1328985852, rs763470424, rs1555139694, rs878854697, rs1555461217, rs1555461765, rs774684620, rs766416564, rs1554558613, rs1305740166, rs1555461460, rs1555461407, rs1555461586, rs1555567202, rs1555607022, rs1555069815, rs1442299125, rs1474786480, rs1555084947, rs1555457867, rs141087784, rs1482641121, rs1564830522, rs1565469955, rs1565503137, rs864622613, rs755263466, rs757679199, rs1593903166, rs1597801649, rs1603293306, rs879253880, rs80358754, rs1597062038, rs45494092, rs1603275367, rs887358871, rs1597091518, rs1966967065, rs1064793049, rs2082872908, rs2085078278, rs2072475243
Developmental delay Global developmental delay, Profound global developmental delay rs28941770, rs199469464, rs281865469, rs143747297, rs398123009, rs587777428, rs786205133, rs606231459, rs797044854, rs797045027, rs864309504, rs878853160, rs886039902, rs886042046, rs886041291, rs886041382, rs1057518991, rs1057518699, rs753254213, rs748294403, rs762552974, rs1135401795, rs1553121073, rs1553122926, rs1364690005, rs1554086554, rs1554210415, rs1554168326, rs1554776342, rs1553873247, rs1567860112, rs779009256, rs1557447255, rs1564568350, rs780011005, rs1597464953, rs1200336864, rs1569513017, rs1587459606, rs1570332505, rs748888652, rs1575155995, rs2087029320, rs1589669105, rs1601769604, rs1184981709, rs749201074
Unknown
Disease name Disease term dbSNP ID References
Camptodactyly of fingers Clinodactyly of the 5th finger
Central visual impairment Central visual impairment
Cerebellar atrophy Cerebellar atrophy
Cerebral cortical atrophy Cerebral cortical atrophy

| © 2021, Biomedical Informatics Centre, NIRRH |
ICMR-National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400012
Tel: +91-22-24192104, Fax No: +91-22-24139412