NLRP12 (NLR family pyrin domain containing 12)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
91662 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
NLR family pyrin domain containing 12 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
NLRP12 |
SynonymsGene synonyms aliases
|
CLR19.3, FCAS2, NALP12, PAN6, PYPAF7, RNO, RNO2 |
ChromosomeChromosome number
|
19 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
19q13.42 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuati |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs34971363 |
G>A,C |
Risk-factor, benign |
Synonymous variant, coding sequence variant, missense variant |
rs35064500 |
G>A,C |
Likely-benign, conflicting-interpretations-of-pathogenicity |
Stop gained, intron variant, coding sequence variant, missense variant |
rs104895565 |
->A,AA |
Not-provided, pathogenic, likely-pathogenic |
Splice donor variant |
rs111754022 |
G>A,C,T |
Conflicting-interpretations-of-pathogenicity |
Coding sequence variant, missense variant |
rs141245482 |
G>A |
Likely-benign, conflicting-interpretations-of-pathogenicity, benign |
Missense variant, coding sequence variant |
rs142487599 |
G>A,C |
Uncertain-significance, likely-benign, pathogenic |
Stop gained, synonymous variant, coding sequence variant |
rs145171629 |
G>A,C |
Likely-pathogenic, likely-benign |
Synonymous variant, coding sequence variant |
rs146245368 |
G>A,T |
Benign, pathogenic |
Stop gained, synonymous variant, coding sequence variant |
rs147080557 |
G>A,C |
Pathogenic |
Missense variant, synonymous variant, coding sequence variant |
rs150280940 |
G>A,T |
Likely-benign, conflicting-interpretations-of-pathogenicity |
Missense variant, coding sequence variant |
rs374537127 |
A>G,T |
Pathogenic |
Synonymous variant, coding sequence variant, stop gained |
rs752809784 |
C>T |
Pathogenic |
Stop gained, coding sequence variant |
rs774895361 |
C>A,T |
Pathogenic |
Missense variant, coding sequence variant, stop gained |
rs1302931500 |
GAAGAACTCACCACAAAGTCCGTAG>- |
Pathogenic |
Intron variant, coding sequence variant, splice donor variant |
rs1342078475 |
AG>- |
Pathogenic |
Intron variant, coding sequence variant, frameshift variant |
rs1404302953 |
C>A,T |
Pathogenic |
Missense variant, coding sequence variant, stop gained, intron variant |
rs1555794506 |
C>T |
Likely-pathogenic |
Splice acceptor variant |
rs1568662444 |
C>T |
Likely-pathogenic |
Intron variant, coding sequence variant, stop gained, synonymous variant |
rs1599842537 |
CCTT>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1599843277 |
C>T |
Pathogenic |
Coding sequence variant, stop gained |
rs1600700389 |
->AA |
Likely-pathogenic |
Frameshift variant, coding sequence variant, intron variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P59046 |
Protein name |
NACHT, LRR and PYD domains-containing protein 12 (Monarch-1) (PYRIN-containing APAF1-like protein 7) (Regulated by nitric oxide) |
Protein function |
Plays an essential role as an potent mitigator of inflammation (PubMed:30559449). Primarily expressed in dendritic cells and macrophages, inhibits both canonical and non-canonical NF-kappa-B and ERK activation pathways (PubMed:15489334, PubMed:1 |
PDB |
2L6A
,
4XHS
,
5H7N
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF02758 |
PYRIN |
12 → 87 |
PAAD/DAPIN/Pyrin domain |
Domain |
PF14484 |
FISNA |
129 → 201 |
Fish-specific NACHT associated domain |
Family |
PF05729 |
NACHT |
211 → 381 |
NACHT domain |
Domain |
PF17779 |
NOD2_WH |
459 → 512 |
NOD2 winged helix domain |
Domain |
PF17776 |
NLRC4_HD2 |
514 → 628 |
NLRC4 helical domain HD2 |
Domain |
PF13516 |
LRR_6 |
825 → 848 |
Leucine Rich repeat |
Repeat |
PF13516 |
LRR_6 |
882 → 905 |
Leucine Rich repeat |
Repeat |
PF13516 |
LRR_6 |
939 → 962 |
Leucine Rich repeat |
Repeat |
PF13516 |
LRR_6 |
997 → 1019 |
Leucine Rich repeat |
Repeat |
|
Sequence |
|
Sequence length |
1061 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Arthritis |
Arthritis |
rs1594890601, rs1594882933, rs184370809, rs776489319, rs1594883470 |
|
Autoinflammatory disease |
Autoinflammatory disorder |
rs777759523, rs121434352, rs28940578, rs28940580, rs121908146, rs121908148, rs121908150, rs80338807, rs121908679, rs104895319, rs104894176, rs28933973, rs28933376, rs137854447, rs61736587, rs148755083, rs104895093, rs104895311, rs104895364, rs104895352, rs104895271, rs104895238, rs151344629, rs180177431, rs376785840, rs587777241, rs77563738, rs202134424, rs864321625, rs864321682, rs864321626, rs864321684, rs864321685, rs869312838, rs869312953, rs766657895, rs140148806, rs753966933, rs764196809, rs200956636, rs147035858, rs1274685768, rs1600700389, rs1776278098, rs754904956, rs1760720617, rs1760720924 |
29248470 |
Cold autoinflammatory syndrome |
Familial Cold Autoinflammatory Syndrome 2 |
rs121908146, rs121908148, rs121908149, rs121908150, rs121908151, rs121908152, rs121908153, rs121908154, rs28937896, rs151344629, rs180177503, rs180177437, rs180177445, rs180177433, rs180177430, rs180177478, rs180177458, rs104895389, rs180177491, rs180177438, rs180177435, rs180177469, rs180177473, rs180177452, rs180177449, rs104895392, rs180177476, rs180177441, rs180177447, rs180177484, rs180177431, rs180177468, rs180177470, rs180177456, rs606231460, rs147080557, rs1404302953, rs1302931500, rs1599842537 |
29248470, 24064030, 18230725 |
Hearing loss |
Sensorineural Hearing Loss (disorder) |
rs267607135, rs267606855, rs779841884, rs267606854, rs28942097, rs121908073, rs121908076, rs74315289, rs121908144, rs111033313, rs74315437, rs121908348, rs121908349, rs121908350, rs397515359, rs180177151, rs180177154, rs180177153, rs35689081, rs35887622, rs80338944, rs104894396, rs104894398, rs80338947, rs80338948, rs80338942, rs104894402, rs104894403, rs80338945, rs28931594, rs80338940, rs80338941, rs80356590, rs80338950, rs387906706, rs387906707, rs387906708, rs398122848, rs387907016, rs587776894, rs387907088, rs397515411, rs370965183, rs398122930, rs199897298, rs111033187, rs111033448, rs199606180, rs111033284, rs397516413, rs111033305, rs111033220, rs111033256, rs111033297, rs111033253, rs104894408, rs111033295, rs397516874, rs76434661, rs111033335, rs397517323, rs111033247, rs367928692, rs374793617, rs143939430, rs397515605, rs80338939, rs200656442, rs779748859, rs587781261, rs587781262, rs143343083, rs200147906, rs730880338, rs797044491, rs146281367, rs756484720, rs869025593, rs201306709, rs540895576, rs777777359, rs879255246, rs1554358720, rs142498437, rs377145777, rs1057517519, rs779077039, rs952741388, rs1060499797, rs764139009, rs1060499590, rs1064794012, rs1064797115, rs756790858, rs775633137, rs1554952443, rs1554952193, rs782063761, rs1199012623, rs756147087, rs1555648043, rs1555661490, rs1553196233, rs781546107, rs111033190, rs775428246, rs782539587, rs537227442, rs148695069, rs1554835827, rs953422571, rs1554834186, rs1554834161, rs1554835103, rs1554577339, rs1554577402, rs768471577, rs782279338, rs781951909, rs998045226, rs375759781, rs755804651, rs1557458426, rs767797828, rs538027448, rs1559366084, rs367688416, rs1558480402, rs1558490542, rs1559870857, rs1560690591, rs1561299289, rs1562817224, rs1562817529, rs1562822565, rs1562835391, rs1564113368, rs1564554255, rs773851192, rs1564555240, rs761261855, rs1564805114, rs1565522273, rs1565127413, rs781790246, rs1565430886, rs1565469959, rs746667217, rs1565819402, rs1565855932, rs150529554, rs1567939793, rs201866631, rs754472294, rs1559372512, rs1558464965, rs1558488902, rs775062249, rs1226171550, rs1561590396, rs765574676, rs762876554, rs757327146, rs1564949059, rs1565519673, rs368050948, rs1565541888, rs781989117, rs1565402473, rs750358148, rs1386887007, rs1209665716, rs1567641234, rs1237955948, rs1569042782, rs752672077, rs146689036, rs1560070780, rs149712664, rs1564556995, rs762226905, rs773573968, rs1568528171, rs1198256157, rs377267777, rs370564476, rs1577876794, rs747787770, rs759432278, rs1043716893, rs1581138934, rs2033773650, rs1421964916, rs771766431, rs780917129, rs1895773215, rs1895769400, rs761543680, rs1565920060 |
|
Papillary renal carcinoma |
Papillary Renal Cell Carcinoma |
rs5030823, rs2137087134, rs121913668, rs121913669, rs121913670, rs121913671, rs121913673, rs121913243, rs786202724 |
23797736 |
Renal carcinoma |
Renal Cell Carcinoma, Conventional (Clear Cell) Renal Cell Carcinoma, Sarcomatoid Renal Cell Carcinoma, Collecting Duct Carcinoma of the Kidney |
rs121913668, rs121913670, rs121913243, rs786202724 |
23797736 |
Schizophrenia |
Schizophrenia, Childhood |
rs74315508, rs74315509, rs13447324, rs1558507406, rs387906932, rs387906933, rs863223354, rs863223355, rs776061422, rs863223349, rs748809996, rs759748655, rs863223353, rs863223350, rs863223356, rs781821239, rs863223348, rs863223346, rs863223347, rs863223351, rs863223352, rs61734270, rs797045205, rs869312829, rs869312830, rs770913157, rs869312832, rs869312831, rs781720548, rs1262969313 |
26508570 |
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Aphthous ulcer |
Recurrent aphthous ulcer |
|
|
Chromophobe carcinoma |
Chromophobe Renal Cell Carcinoma |
rs137853247 |
23797736 |
Urticaria |
Urticaria |
|
|
|
|
|