ORAI1 (ORAI calcium release-activated calcium modulator 1)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
84876 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
ORAI calcium release-activated calcium modulator 1 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
ORAI1 |
SynonymsGene synonyms aliases
|
CRACM1, IMD9, ORAT1, TAM2, TMEM142A |
ChromosomeChromosome number
|
12 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
12q24.31 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
The protein encoded by this gene is a membrane calcium channel subunit that is activated by the calcium sensor STIM1 when calcium stores are depleted. This type of channel is the primary way for calcium influx into T-cells. Defects in this gene are a caus |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs118203993 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs587777528 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs782753385 |
T>C |
Pathogenic |
Missense variant, coding sequence variant |
rs786204796 |
G>A,C |
Pathogenic |
Missense variant, coding sequence variant |
rs786204797 |
C>T |
Pathogenic |
Missense variant, coding sequence variant |
rs786205890 |
C>A |
Pathogenic |
Missense variant, coding sequence variant |
rs878853261 |
->A |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1555322558 |
->CCGCCGCCGCAGCGGGGACGGGGAGCCCCCGGGGGCC |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1555322610 |
C>G |
Pathogenic |
Missense variant, coding sequence variant |
rs1594212582 |
C>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
GO ID |
Ontology |
Definition |
Evidence |
Reference |
GO:0002115 |
Process |
Store-operated calcium entry |
IBA |
21873635 |
GO:0002115 |
Process |
Store-operated calcium entry |
IDA |
28219928 |
GO:0002250 |
Process |
Adaptive immune response |
IEA |
|
GO:0005262 |
Function |
Calcium channel activity |
IDA |
31009446 |
GO:0005515 |
Function |
Protein binding |
IPI |
17360584, 17905723, 19249086, 19706554, 19887627, 20418871, 20887894, 21408196, 21427704, 21876174, 22451904, 22464749, 22494970, 22586105, 23307288, 24954132, 24996186, 27185316, 28219928, 30481768 |
GO:0005516 |
Function |
Calmodulin binding |
IEA |
|
GO:0005829 |
Component |
Cytosol |
IDA |
|
GO:0005886 |
Component |
Plasma membrane |
IDA |
19171672, 27185316 |
GO:0005887 |
Component |
Integral component of plasma membrane |
IDA |
16645049, 28219928 |
GO:0015279 |
Function |
Store-operated calcium channel activity |
IBA |
21873635 |
GO:0015279 |
Function |
Store-operated calcium channel activity |
IDA |
16645049, 16733527, 16766533, 16807233, 23307288, 28219928 |
GO:0016020 |
Component |
Membrane |
HDA |
19946888 |
GO:0016020 |
Component |
Membrane |
IBA |
21873635 |
GO:0016323 |
Component |
Basolateral plasma membrane |
IEA |
|
GO:0034704 |
Component |
Calcium channel complex |
ISS |
31009446 |
GO:0042802 |
Function |
Identical protein binding |
IPI |
18757751, 19249086, 20018736, 20194792, 24996186 |
GO:0044853 |
Component |
Plasma membrane raft |
IDA |
19171672 |
GO:0045121 |
Component |
Membrane raft |
IDA |
22494970 |
GO:0045762 |
Process |
Positive regulation of adenylate cyclase activity |
IDA |
19171672 |
GO:0051924 |
Process |
Regulation of calcium ion transport |
IMP |
16921383 |
GO:0051928 |
Process |
Positive regulation of calcium ion transport |
IDA |
16645049, 16733527, 16766533, 16807233 |
GO:0061180 |
Process |
Mammary gland epithelium development |
IEA |
|
GO:0070509 |
Process |
Calcium ion import |
IEA |
|
GO:0070588 |
Process |
Calcium ion transmembrane transport |
IDA |
31009446 |
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
Q96D31 |
Protein name |
Calcium release-activated calcium channel protein 1 (Protein orai-1) (Transmembrane protein 142A) |
Protein function |
Pore-forming subunit of two major inward rectifying Ca(2+) channels at the plasma membrane: Ca(2+) release-activated Ca(2+) (CRAC) channels and arachidonate-regulated Ca(2+)-selective (ARC) channels (Probable) (PubMed:16645049, PubMed:16733527, |
PDB |
2MAK
,
4EHQ
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF07856 |
Orai-1 |
71 → 267 |
Mediator of CRAC channel activity |
Family |
|
Sequence |
|
Sequence length |
301 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Amelogenesis imperfecta |
Amelogenesis Imperfecta |
rs267607178, rs143816093, rs606231351, rs137854435, rs137854440, rs137854441, rs137854444, rs587776587, rs121908109, rs587776588, rs140213840, rs104894704, rs387906487, rs387906488, rs387906489, rs104894733, rs104894734, rs104894736, rs387906490, rs387906491, rs104894737, rs104894738, rs144411158, rs587776911, rs587776912, rs587776913, rs587776914, rs387907215, rs866941536, rs1560562738, rs1560562630, rs146645381, rs1560558455, rs587777515, rs587777516, rs587777530, rs139620139, rs587777531, rs587777535, rs587777536, rs587777537, rs606231462, rs1553275034, rs869320671, rs786201004, rs140015315, rs730882118, rs730880297, rs730880298, rs786204825, rs786204826, rs1555409827, rs1057517671, rs1057517672, rs556734208, rs146238585, rs202073531, rs1057519277, rs767907487, rs779823931, rs1060499539, rs1085307111, rs546603773, rs1553275070, rs1553275195, rs752102959, rs1554623490, rs1553888384, rs770804941, rs1553887511, rs557128345, rs1568724130, rs199527325, rs1603038146, rs773117913, rs1560973571, rs1560782372, rs1560980659, rs1560973467, rs772929908, rs762816338, rs1565222166, rs1595312054, rs1866200282, rs2086254952 |
|
Anemia |
Anemia |
rs118204044, rs118204045, rs118204046, rs121918330, rs869320719, rs869312029, rs121918332, rs869320724, rs767094129, rs786205058, rs786205059, rs137853119, rs137853120, rs137853121, rs1384933966, rs137853122, rs137853123, rs786205060, rs267607121, rs121908584, rs80338697, rs80338699, rs120074166, rs120074167, rs1050828, rs74575103, rs137852314, rs5030868, rs137852316, rs137852317, rs137852318, rs137852319, rs137852320, rs137852321, rs137852322, rs137852323, rs137852324, rs72554665, rs387906468, rs5030872, rs137852326, rs137852333, rs137852327, rs137852328, rs137852329, rs137852330, rs137852331, rs137852332, rs137852334, rs137852335, rs137852336, rs137852339, rs76645461, rs137852340, rs137852341, rs78478128, rs137852343, rs137852344, rs137852345, rs587776730, rs137852346, rs137852347, rs137852349, rs2070404412, rs2070350038, rs2070350009, rs137852303, rs137852304, rs33946267, rs34378160, rs33933298, rs11549407, rs35724775, rs34598529, rs41469945, rs267607201, rs80338694, rs80338696, rs387907018, rs398123546, rs78365220, rs587777100, rs587777101, rs483352840, rs869312752, rs765487627, rs1557229599, rs1557230040, rs1555524842, rs782090947, rs1358275550, rs1557229736, rs1557230573, rs1556323334, rs1233124208, rs1293528130, rs146864395, rs1595503440, rs1603411214, rs137852325, rs1575247302, rs1603411177, rs1336651679, rs782322505 |
|
Centronuclear myopathy |
Centronuclear myopathy, Autosomal Recessive Centronuclear Myopathy, Autosomal Dominant Myotubular Myopathy |
rs80356529, rs121909089, rs121909090, rs121909091, rs121909092, rs121909095, rs132630304, rs587783791, rs397518445, rs132630306, rs122458143, rs587783594, rs587783595, rs587783597, rs587783598, rs587783832, rs587783838, rs587783841, rs587783771, rs587783772, rs587783781, rs574660186, rs794729338, rs587783752, rs878854372, rs926741242, rs1293675104, rs768407867, rs773598203, rs1555715869, rs781933660, rs1332371891, rs756870293, rs1568454672, rs1600843056, rs866050664, rs2093158866, rs776252106, rs756847750, rs2070649864 |
|
Congenital myopathy with fiber type disproportion |
Congenital Fiber Type Disproportion |
rs121908184, rs121908188, rs121964853, rs121964854, rs121909529, rs121909531, rs367543058, rs118192117, rs143849895, rs367543055, rs367543049, rs367543048, rs118192178, rs193922810, rs587783772, rs2754158, rs727503263, rs797045950, rs886041686, rs1557813850, rs1057518940, rs1060505018, rs1566521710, rs1558081664, rs778603129, rs1475149579 |
|
Ectodermal dysplasia |
Ectodermal Dysplasia |
rs74315309, rs121908116, rs1558814967, rs121908450, rs121908452, rs121908453, rs797044435, rs121908454, rs121908455, rs121908456, rs797044436, rs797044437, rs137853324, rs137853325, rs137853326, rs137853327, rs137853328, rs137853329, rs1569556603, rs2147483647, rs137853330, rs28933100, rs121913665, rs387907197, rs386134238, rs386134240, rs782540538, rs398122913, rs398122377, rs179363867, rs1565766888, rs747806672, rs879255553, rs886039564, rs886041005, rs766500689, rs886041411, rs782178147, rs1057519508, rs1057524917, rs139455627, rs1060499610, rs1553445945, rs1553448320, rs557166582, rs1569151872, rs1555916009, rs1566591076, rs1566591086, rs1566591082, rs1558814135, rs773885029, rs1590674994, rs1575653629, rs1575647025, rs781890406, rs749688157 |
|
Hypertension |
Hypertensive disease |
rs13306026, rs13333226 |
19897708 |
Ichthyosis |
Ichthyoses |
rs199766569, rs587776996, rs587777262, rs863223405, rs370031870, rs1569044747, rs200806519 |
|
Myopathy |
Myopathy, Myopathy, Centronuclear, Autosomal Dominant, MYOPATHY, TUBULAR AGGREGATE, 1, MYOPATHY, TUBULAR AGGREGATE, 2, Myopathy, Centronuclear, 1 |
rs137854521, rs386834236, rs121908557, rs121909092, rs111033570, rs104894299, rs104894294, rs121909273, rs121909274, rs121909275, rs199474699, rs199476140, rs118192165, rs118192169, rs118192166, rs193922856, rs281865489, rs397514675, rs397514676, rs397514677, rs367543058, rs118192117, rs193922837, rs118192129, rs118192143, rs118192153, rs118192133, rs118192156, rs118192149, rs118192148, rs118192183, rs118192147, rs118192123, rs118192127, rs118192142, rs118192144, rs118192178, rs118192151, rs118192150, rs118192184, rs118192154, rs118192134, rs118192155, rs193922893, rs118192132, rs118192146, rs193922867, rs193922884, rs587777528, rs527236030, rs587777672, rs587777673, rs587777674, rs587777675, rs587783343, rs2754158, rs786204796, rs748277951, rs797046047, rs797046064, rs797046060, rs797045479, rs797045931, rs797045932, rs797045934, rs797045935, rs797045477, rs797045478, rs1057518851, rs1057518855, rs1057518773, rs1057518866, rs1555322610, rs1555806119, rs761483896, rs144071404, rs1198364572, rs1568614042, rs978984063, rs1568604308, rs1332371891, rs1601842249, rs777176261, rs1249621033, rs1278804520, rs1568613962, rs1568510406, rs1597512576, rs193922887, rs371455345, rs1603452200, rs1599634685, rs1575065895, rs1575201712, rs139715157, rs1974129338 |
25227914, 28058752, 24591628 |
Severe combined immunodeficiency disease |
Combined immunodeficiency, Combined immunodeficiency due to ORAI1 deficiency |
rs886037607, rs118203993, rs121908714, rs121908739, rs121908740, rs121908735, rs121908721, rs121908722, rs121908156, rs1564414523, rs1564418254, rs1564446526, rs786205074, rs121908157, rs121908159, rs786200884, rs397515357, rs104894562, rs137852624, rs137852625, rs137852626, rs137852627, rs137852507, rs137852509, rs111033619, rs111033620, rs1569480018, rs111033621, rs137852510, rs587776729, rs111033622, rs111033617, rs111033618, rs121917894, rs121917896, rs2133313409, rs121917897, rs28933392, rs104894282, rs104894283, rs104894285, rs121918570, rs121918572, rs730880318, rs104893674, rs730880319, rs104894453, rs104894454, rs104894451, rs137853206, rs777503956, rs267606645, rs267606648, rs397515390, rs193922346, rs193922347, rs193922348, rs193922349, rs193922350, rs137852508, rs193922640, rs193922641, rs193922643, rs193922645, rs193922361, rs193922364, rs193922464, rs148508754, rs193922574, rs113994174, rs606231246, rs397514671, rs397514686, rs397514755, rs199474679, rs199474685, rs199474686, rs199474681, rs150739647, rs267605358, rs886041036, rs587777335, rs587778405, rs145092287, rs587777562, rs606231256, rs200296680, rs786205456, rs786205517, rs774202259, rs786205615, rs878853261, rs786205890, rs782753385, rs746052951, rs869025224, rs869312857, rs869320660, rs869320659, rs869320658, rs879253742, rs886037924, rs886037925, rs750610248, rs886039394, rs761242509, rs886039387, rs886041043, rs886041044, rs886042051, rs886041333, rs749481781, rs1057517747, rs1057519506, rs1057523762, rs1057521062, rs1057520644, rs761583890, rs751635016, rs55729925, rs1064793248, rs1064793347, rs1064794027, rs781410769, rs1555524788, rs1486760100, rs769633203, rs1556330713, rs1555322558, rs1556330234, rs1556330755, rs1556329779, rs1556330552, rs1556329822, rs1556330286, rs1556331272, rs2146178281, rs376610445, rs757797994, rs775704953, rs1555743321, rs1564995660, rs1564995662, rs1556330249, rs144104577, rs886041796, rs1026474882, rs570768621, rs1556330562, rs1556330568, rs780014431, rs778343059, rs1555844617, rs1567629968, rs1567628757, rs1567629943, rs1567632864, rs1567632829, rs1567626023, rs1559328006, rs1561423197, rs1452483770, rs1568400897, rs1569479913, rs1568404443, rs1569480047, rs1563340753, rs368303189, rs1568431262, rs1568431102, rs1561424886, rs1602289943, rs1241698978, rs1569479994, rs1569480082, rs1602289649, rs1573261820, rs770985198, rs1589050343, rs1340132582, rs1589064324, rs1589070600, rs1213680890, rs149316157, rs1599873591, rs755706305, rs1602288051, rs1602289411, rs1602289183, rs1583513256, rs1589136659, rs1380154594, rs1011307501, rs1599876167, rs1569967422, rs1602289631, rs1573262398, rs760191638, rs1592117677, rs1640406042, rs372597855, rs1839558393, rs1839622622, rs1839957089, rs777008519, rs1233957241, rs2092261618, rs1839255008, rs1677695565, rs936493226, rs1162344514, rs991089005 |
20004786 |
Stormorken syndrome |
Stormorken Syndrome |
rs483352867, rs527236030 |
24591628 |
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Aphthous ulcer |
Recurrent aphthous ulcer |
|
|
Centronuclear myopathy, x-linked |
X-linked centronuclear myopathy |
|
|
Asplenia |
Congenital absence of spleen |
|
|
Congenital structural myopathy |
Congenital Structural Myopathy |
|
|
Dwarfism |
Dwarfism |
|
|
Immune dysfunction with t-cell inactivation |
Immune dysfunction with T-cell inactivation due to calcium entry defect 1 |
|
16147976, 16582901, 20004786 |
Immunologic deficiency syndromes |
Immunologic Deficiency Syndromes |
|
|
Mental depression |
Major Depressive Disorder |
rs587778876, rs587778877 |
27777418 |
Miosis disorder |
Miosis disorder |
|
|
Speech disorders |
Speech Disorders |
|
|
Stomatitis |
Stomatitis |
|
|
Stormorken-sjaastad-langslet syndrome |
Stormorken-Sjaastad-Langslet syndrome |
|
|
Tubular aggregate myopathy |
Tubular Aggregate Myopathy |
|
24591628 |
|
|
|