GediPNet logo

FUZ (fuzzy planar cell polarity protein)
Gene
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
80199
Gene nameGene Name - the full gene name approved by the HGNC.
Fuzzy planar cell polarity protein
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
FUZ
SynonymsGene synonyms aliases
CPLANE3, FY, NTD
ChromosomeChromosome number
19
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
19q13.33
SummarySummary of gene provided in NCBI Entrez Gene.
This gene encodes a planar cell polarity protein that is involved in ciliogenesis and directional cell movement. Knockout studies in mice exhibit neural tube defects and defective cilia, and mutations in this gene are associated with neural tube defects i
SNPsSNP information provided by dbSNP.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
SNP ID Visualize variation Clinical significance Consequence
rs387907204 G>A Risk-factor Coding sequence variant, non coding transcript variant, 5 prime UTR variant, missense variant, intron variant
rs548706733 AGGCCCCACCTGCTGACGGGCGG>- Pathogenic Coding sequence variant, non coding transcript variant, 5 prime UTR variant, splice donor variant, intron variant
miRNAmiRNA information provided by mirtarbase database.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
miRTarBase ID miRNA Experiments Reference
MIRT042014 hsa-miR-484 CLASH 23622248
MIRT1007023 hsa-miR-1254 CLIP-seq
MIRT1007024 hsa-miR-1275 CLIP-seq
MIRT1007025 hsa-miR-181a CLIP-seq
MIRT1007026 hsa-miR-181b CLIP-seq
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
GO ID Ontology Definition Evidence Reference
GO:0001736 Process Establishment of planar polarity ISS
GO:0001843 Process Neural tube closure IMP 21840926
GO:0001843 Process Neural tube closure ISS
GO:0001942 Process Hair follicle development ISS
GO:0005515 Function Protein binding IPI 16189514, 32296183
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
MIM
HGNC
e!Ensembl
Protein
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
UniProt ID Q9BT04
Protein name Protein fuzzy homolog
Protein function Probable planar cell polarity effector involved in cilium biogenesis. May regulate protein and membrane transport to the cilium. Proposed to function as core component of the CPLANE (ciliogenesis and planar polarity effectors) complex involved i
PDB 7Q3D
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF19036 Fuz_longin_1
10 → 138
First Longin domain of FUZ, MON1 and HPS1
 Domain
PF19037 Fuz_longin_2
174 → 269
Second Longin domain of FUZ, MON1 and HPS1
 Domain
PF19038 Fuz_longin_3
295 → 417
Third Longin domain of FUZ, MON1 and HPS1
 Domain
Sequence
Sequence length 418
Interactions View interactions
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
 
Reactome
    Hedgehog 'off' state
Associated diseases
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Causal
Disease name Disease term dbSNP ID References
Anencephaly Anencephaly, Iniencephaly, Exencephaly rs773607884
Cryptorchidism Cryptorchidism rs121912555, rs104894697, rs104894698, rs398122886
Hydrocephalus Hydrocephalus rs387907320, rs369384363, rs387907321, rs372127610, rs770273135, rs797045095, rs797045707, rs769795916, rs781251438, rs922703465, rs376078512, rs1567043467, rs1587149916, rs1586841546
Hypertension Hypertensive disease rs13306026, rs13333226
Unknown
Disease name Disease term dbSNP ID References
Acrania Acrania
Ambiguous genitalia Ambiguous Genitalia rs782562963
Arnold-chiari malformation Arnold Chiari Malformation 21840926
Arrhinencephaly Arhinencephaly

| © 2021, Biomedical Informatics Centre, NIRRH |
ICMR-National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400012
Tel: +91-22-24192104, Fax No: +91-22-24139412