Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
7369 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Uromodulin |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
UMOD |
SynonymsGene synonyms aliases
|
ADMCKD2, ADTKD1, FJHN, HNFJ, HNFJ1, MCKD2, THGP, THP |
ChromosomeChromosome number
|
16 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
16p12.3 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
The protein encoded by this gene is the most abundant protein in mammalian urine under physiological conditions. Its excretion in urine follows proteolytic cleavage of the ectodomain of its glycosyl phosphatidylinosital-anchored counterpart that is situat |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs28934582 |
C>T |
Pathogenic |
Non coding transcript variant, missense variant, coding sequence variant |
rs28934583 |
A>C,G |
Pathogenic |
Non coding transcript variant, missense variant, coding sequence variant |
rs28934584 |
C>A,G,T |
Pathogenic |
Non coding transcript variant, missense variant, coding sequence variant |
rs121917768 |
C>G,T |
Likely-pathogenic, pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs121917769 |
A>G |
Pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs121917770 |
T>C |
Pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs121917771 |
C>T |
Pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs121917772 |
A>C |
Pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs121917773 |
A>G |
Pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs121917774 |
C>A |
Pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs398122388 |
C>G |
Pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs398123697 |
C>A,T |
Conflicting-interpretations-of-pathogenicity, pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs398123698 |
C>T |
Pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs750535100 |
G>A,T |
Likely-pathogenic |
Missense variant, synonymous variant, non coding transcript variant, coding sequence variant |
rs780462125 |
A>T |
Likely-pathogenic |
Coding sequence variant, non coding transcript variant, missense variant |
rs878855325 |
CTTCGGGGCAGA>AGGAGGCGG |
Pathogenic |
Non coding transcript variant, inframe indel, coding sequence variant |
rs886043751 |
G>A,C,T |
Pathogenic |
Coding sequence variant, missense variant, non coding transcript variant, synonymous variant, stop gained |
rs1057515585 |
C>A,T |
Pathogenic |
Stop gained, non coding transcript variant, coding sequence variant, missense variant |
rs1057522004 |
T>C |
Likely-pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs1060499657 |
T>C |
Likely-pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs1447458978 |
G>A |
Pathogenic |
Missense variant, non coding transcript variant, coding sequence variant |
rs1555486021 |
C>T |
Likely-pathogenic |
Missense variant, non coding transcript variant, genic downstream transcript variant, coding sequence variant |
rs1555487316 |
A>C |
Likely-pathogenic |
Missense variant, non coding transcript variant, coding sequence variant |
rs1555487318 |
T>G |
Pathogenic |
Missense variant, non coding transcript variant, coding sequence variant |
rs1555487528 |
GCGCCAGTACTCGTCCAGGGTGCGGTG>- |
Pathogenic |
Inframe deletion, non coding transcript variant, coding sequence variant |
rs1555487621 |
A>C |
Pathogenic |
Missense variant, non coding transcript variant, coding sequence variant |
rs1555487726 |
C>T |
Likely-pathogenic |
Missense variant, non coding transcript variant, coding sequence variant |
rs1567309582 |
C>G |
Likely-pathogenic |
Missense variant, non coding transcript variant, coding sequence variant |
rs1567309965 |
C>T |
Likely-pathogenic |
Missense variant, non coding transcript variant, coding sequence variant |
rs1567310019 |
G>C |
Pathogenic |
Missense variant, non coding transcript variant, coding sequence variant |
rs1567310155 |
G>A |
Pathogenic |
Missense variant, non coding transcript variant, coding sequence variant |
rs1567311279 |
A>T |
Likely-pathogenic |
Missense variant, non coding transcript variant, coding sequence variant |
rs1567311288 |
A>G |
Likely-pathogenic |
Missense variant, non coding transcript variant, coding sequence variant |
rs1596560944 |
C>T |
Pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs1596561934 |
G>C |
Pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Transcription factors
|
Transcription factor |
Regulation |
Reference |
HNF1B |
Activation |
18846391 |
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P07911 |
Protein name |
Uromodulin (Tamm-Horsfall urinary glycoprotein) (THP) [Cleaved into: Uromodulin, secreted form] |
Protein function |
[Uromodulin]: Functions in biogenesis and organization of the apical membrane of epithelial cells of the thick ascending limb of Henle's loop (TALH), where it promotes formation of complex filamentous gel-like structure that may play a role in t |
PDB |
4WRN
,
6TQK
,
6TQL
,
6ZS5
,
6ZYA
,
7PFP
,
7Q3N
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF12947 |
EGF_3 |
31 → 63 |
EGF domain |
Domain |
PF07645 |
EGF_CA |
65 → 106 |
Calcium-binding EGF domain |
Domain |
PF07645 |
EGF_CA |
108 → 161 |
Calcium-binding EGF domain |
Domain |
PF00100 |
Zona_pellucida |
335 → 583 |
Zona pellucida-like domain |
Family |
|
Sequence |
|
Sequence length |
640 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Diabetes |
Diabetes |
rs80356611 |
29703844 |
Diabetes mellitus |
Diabetes Mellitus, Diabetes Mellitus, Non-Insulin-Dependent |
rs587776515, rs61730328, rs606231121, rs606231122, rs79020217, rs77625743, rs78378398, rs606231123, rs4402960, rs1362648752, rs3745368, rs3792267, rs3842570, rs5030952, rs2975760, rs119489103, rs7903146, rs12255372, rs11196205, rs104893649, rs80356624, rs80356616, rs80356625, rs80356611, rs104894237, rs80356613, rs137852740, rs137852786, rs387906407, rs151344623, rs28938469, rs28936371, rs137852672, rs80356637, rs80356642, rs80356653, rs137852673, rs137852674, rs80356634, rs80356651, rs193929360, rs137853334, rs137853335, rs137853336, rs1600731198, rs137853338, rs121964882, rs121964883, rs387906511, rs121964884, rs121964885, rs2147483647, rs387906512, rs121964887, rs121964888, rs121964889, rs121964890, rs121964891, rs28934878, rs74315383, rs121964893, rs886037620, rs886037621, rs80356663, rs121434593, rs121913150, rs587776825, rs137853236, rs2135842335, rs137853237, rs137853238, rs2135818776, rs1566092470, rs1463923467, rs137853243, rs137853244, rs2135839114, rs137853245, rs2135847417, rs121918407, rs104894005, rs104894006, rs80356655, rs104894008, rs104894009, rs104894010, rs104894011, rs80356654, rs104894016, rs193929376, rs193929374, rs193929375, rs193929373, rs80356666, rs80356669, rs80356664, rs193929366, rs1048095, rs193929355, rs193929356, rs1259467443, rs104893642, rs387906777, rs387906779, rs141804752, rs182349376, rs184917682, rs193922396, rs193922400, rs193922401, rs137852676, rs193922407, rs193922638, rs193922257, rs193922258, rs193922259, rs193922260, rs193922261, rs193922262, rs193922263, rs193922264, rs193922265, rs193922268, rs193921338, rs193922269, rs193922272, rs193922273, rs193922275, rs193922278, rs193922279, rs193922280, rs193922281, rs193922282, rs193922283, rs193922284, rs193922286, rs193922287, rs193922289, rs193922291, rs193922295, rs193922297, rs193922300, rs193922302, rs193922303, rs193922308, rs193922313, rs193922314, rs144723656, rs193922315, rs193922316, rs193922317, rs148311934, rs193922319, rs193922320, rs193922326, rs193922329, rs193922330, rs193922331, rs193922335, rs193922336, rs193922338, rs193922340, rs193922341, rs193922471, rs193922475, rs193922476, rs193922479, rs193922355, rs193922356, rs193922576, rs193922578, rs193922582, rs193922588, rs193922592, rs193922594, rs193922596, rs386134267, rs193922598, rs193922599, rs193922600, rs193922604, rs193922605, rs397514580, rs397515519, rs267601516, rs587780343, rs587780345, rs587780346, rs587780347, rs587780357, rs148954387, rs61736969, rs587783673, rs587783672, rs587783669, rs786204676, rs794727236, rs151344624, rs794727775, rs794727839, rs199946797, rs869320673, rs796065047, rs759072800, rs797045595, rs797045209, rs797045207, rs797045213, rs797045623, rs863225280, rs149703259, rs864321656, rs139964066, rs777870079, rs878853246, rs769268803, rs886039380, rs886041392, rs886041391, rs886042610, rs143064649, rs1057516192, rs746480424, rs1057516281, rs576684889, rs754728827, rs1057520291, rs1057520779, rs893256143, rs1057520504, rs1057524790, rs1057524902, rs1057524904, rs1057524905, rs764232985, rs1064793998, rs1064794268, rs769086289, rs369429452, rs1085307913, rs1131691416, rs765432081, rs1131692182, rs748749585, rs1554335441, rs762263694, rs1312678560, rs767565869, rs1375656631, rs1554335391, rs1360415315, rs1554335616, rs1554335752, rs1554909277, rs769518471, rs757171524, rs768951263, rs762703502, rs1555212248, rs1555212359, rs1555813319, rs1555816654, rs1553638903, rs1553638909, rs948820149, rs371977235, rs1553784995, rs76474829, rs200998587, rs1415041911, rs1554334894, rs1260178539, rs1554335421, rs1555211904, rs779184183, rs1554335564, rs200670692, rs1400535021, rs1554334872, rs1555212749, rs1553876668, rs1553878211, rs954727530, rs1554924035, rs372307320, rs925231098, rs1554913069, rs1554933565, rs766431403, rs746714109, rs751279984, rs770664202, rs1008906426, rs758844607, rs1554924540, rs1566092307, rs753998395, rs1565885935, rs1167124132, rs1376796469, rs556436603, rs1562715657, rs1486280029, rs1564869850, rs755259997, rs769569410, rs1172328722, rs1286294151, rs1375557127, rs1568731279, rs1562715426, rs556581174, rs1564865302, rs1565886545, rs776793516, rs1568724014, rs1392795567, rs781260712, rs1562719705, rs1382448285, rs1564977373, rs750586210, rs1598842892, rs1583592247, rs780612692, rs1593060859, rs1476637197, rs751279776, rs1593060890, rs1191912908, rs1167675604, rs1583601110, rs1593058932, rs778611627, rs753296261 |
29703844 |
Hypertension |
Hypertensive disease, Essential Hypertension |
rs13306026, rs13333226 |
21082022, 27618447, 22228705 |
Hyperuricemic nephropathy |
Hyperuricemic Nephropathy, Familial Juvenile 1 |
rs879255648, rs752745051 |
14570709, 15983957, 23197950, 22776760, 12629136, 12900848, 15086896, 15575003, 21060763, 14569098, 12471200, 25436415, 23988501, 17010121 |
Kidney disease |
Kidney Diseases, Chronic kidney disease stage 5 |
rs74315342, rs749740335, rs757649673, rs112417755, rs35138315 |
19430482, 8486146 |
Renal insufficiency |
Renal Insufficiency |
rs1596536873 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Ciliopathies |
Ciliopathies |
|
|
Cystic kidney disease |
Cystic Kidney Diseases |
|
29180396 |
Glomerulocystic kidney disease with hyperuricemia and isosthenuria |
Glomerulocystic Kidney Disease with Hyperuricemia and Isosthenuria |
|
15983957, 17010121, 14570709 |
Gout |
Gout |
|
|
Hypertensive nephropathy |
hypertensive nephropathy |
|
|
Hyperuricemia |
Hyperuricemia |
|
29124443 |
Kidney failure |
Kidney Failure, Chronic |
|
20686651, 29124443, 26831199 |
Medullary cystic kidney disease |
Medullary Cystic Kidney Disease Type 2 |
|
14531790, 14570709, 17010121, 15983957, 25436415, 27729211, 14569098, 12471200 |
Multiple renal cysts |
Multiple renal cysts |
|
|
Multiple small medullary renal cysts |
Multiple small medullary renal cysts |
|
|
Nephritis |
Nephritis, Nephritis, Interstitial, Nephritis, Tubulointerstitial |
|
|
Renal corticomedullary cysts |
Renal corticomedullary cysts |
|
|
Renal glomerular disease |
Renal glomerular disease |
|
|
Tubulointerstitial kidney disease |
UMOD-related autosomal dominant tubulointerstitial kidney disease |
|
|
|
|
|