SLC4A1 (solute carrier family 4 member 1 (Diego blood group))
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
6521 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Solute carrier family 4 member 1 (Diego blood group) |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
SLC4A1 |
SynonymsGene synonyms aliases
|
AE1, BND3, CD233, CHC, DI, EMPB3, EPB3, FR, RTA1A, SAO, SPH4, SW, WD, WD1, WR |
ChromosomeChromosome number
|
17 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
17q21.31 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs5036 |
T>C |
Pathogenic, benign, likely-benign |
Coding sequence variant, missense variant, 5 prime UTR variant |
rs2285644 |
G>A,T |
Pathogenic, benign, likely-benign |
Coding sequence variant, genic downstream transcript variant, downstream transcript variant, missense variant |
rs13306787 |
C>A,T |
Pathogenic, uncertain-significance |
Stop gained, missense variant, coding sequence variant |
rs28929480 |
C>T |
Pathogenic |
Missense variant, coding sequence variant |
rs28931583 |
G>A,C,T |
Pathogenic |
Missense variant, coding sequence variant |
rs28931584 |
C>T |
Pathogenic |
Missense variant, coding sequence variant |
rs28931585 |
G>A,T |
Pathogenic |
Genic downstream transcript variant, downstream transcript variant, coding sequence variant, synonymous variant, missense variant |
rs45562031 |
C>T |
Likely-pathogenic, likely-benign, uncertain-significance |
5 prime UTR variant, missense variant, coding sequence variant |
rs56361140 |
G>A,C,T |
Pathogenic |
Stop gained, missense variant, coding sequence variant, synonymous variant |
rs75731670 |
C>G,T |
Affects |
Missense variant, coding sequence variant |
rs121912741 |
C>T |
Pathogenic |
3 prime UTR variant, coding sequence variant, missense variant |
rs121912742 |
G>A |
Pathogenic |
Coding sequence variant, stop gained |
rs121912743 |
C>G,T |
Affects |
Coding sequence variant, missense variant |
rs121912744 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs121912745 |
G>A,T |
Pathogenic |
Coding sequence variant, missense variant |
rs121912746 |
G>A |
Pathogenic |
Coding sequence variant, intron variant, missense variant |
rs121912748 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs121912749 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs121912750 |
T>C |
Pathogenic |
Missense variant, coding sequence variant, downstream transcript variant, genic downstream transcript variant |
rs121912751 |
G>T |
Pathogenic, uncertain-significance |
Missense variant, coding sequence variant, downstream transcript variant, genic downstream transcript variant |
rs121912752 |
ACC>- |
Pathogenic |
Coding sequence variant, downstream transcript variant, inframe deletion, genic downstream transcript variant |
rs121912753 |
A>G |
Pathogenic |
3 prime UTR variant, coding sequence variant, missense variant |
rs121912754 |
C>G,T |
Pathogenic |
Coding sequence variant, intron variant, missense variant |
rs121912755 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs121912756 |
C>T |
Affects |
Coding sequence variant, missense variant |
rs121912757 |
C>T |
Pathogenic, uncertain-significance |
Coding sequence variant, missense variant |
rs121912758 |
G>A,T |
Pathogenic |
Coding sequence variant, synonymous variant, missense variant |
rs121912759 |
G>A |
Pathogenic, uncertain-significance |
Missense variant, coding sequence variant, downstream transcript variant, genic downstream transcript variant |
rs147390654 |
C>A,T |
Conflicting-interpretations-of-pathogenicity, not-provided |
Missense variant, coding sequence variant |
rs373916826 |
G>A,T |
Pathogenic |
Synonymous variant, coding sequence variant, missense variant |
rs387906565 |
C>T |
Pathogenic |
Upstream transcript variant, genic upstream transcript variant, 5 prime UTR variant |
rs387906566 |
->CATCTGGGTG |
Pathogenic |
Genic downstream transcript variant, downstream transcript variant, coding sequence variant, frameshift variant |
rs750930293 |
G>A,T |
Pathogenic |
Coding sequence variant, stop gained, synonymous variant |
rs769664228 |
GGCAGCCAGGACCTGGGGGCTGAATGC>- |
Pathogenic, protective |
Inframe deletion, coding sequence variant |
rs772264078 |
G>T |
Likely-pathogenic |
Intron variant |
rs863225461 |
A>G |
Pathogenic |
Missense variant, coding sequence variant |
rs863225462 |
T>C |
Pathogenic |
Missense variant, coding sequence variant |
rs863225463 |
A>G |
Pathogenic |
Missense variant, coding sequence variant |
rs866727908 |
C>T |
Likely-pathogenic |
Missense variant, genic downstream transcript variant, coding sequence variant, downstream transcript variant |
rs878853002 |
C>T |
Pathogenic |
Missense variant, coding sequence variant, intron variant |
rs1057518222 |
TGTTGGGGGAG>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1555596072 |
G>C |
Pathogenic |
Stop gained, coding sequence variant |
rs1555596165 |
A>C |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1555596483 |
C>T |
Pathogenic |
Splice donor variant |
rs1555596757 |
T>C |
Pathogenic |
Splice acceptor variant |
rs1567830555 |
C>T |
Likely-pathogenic |
Splice donor variant, intron variant |
rs1567834739 |
C>T |
Pathogenic |
Splice donor variant |
rs1598299485 |
C>T |
Pathogenic |
Missense variant, coding sequence variant |
rs1598301457 |
->C |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1598302037 |
C>T |
Pathogenic |
Coding sequence variant, stop gained |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P02730 |
Protein name |
Band 3 anion transport protein (Anion exchange protein 1) (AE 1) (Anion exchanger 1) (Solute carrier family 4 member 1) (CD antigen CD233) |
Protein function |
Functions both as a transporter that mediates electroneutral anion exchange across the cell membrane and as a structural protein (PubMed:10926824, PubMed:14734552, PubMed:1538405, PubMed:16227998, PubMed:20151848, PubMed:24121512, PubMed:2838730 |
PDB |
1BH7
,
1BNX
,
1BTQ
,
1BTR
,
1BTS
,
1BTT
,
1BZK
,
1HYN
,
2BTA
,
2BTB
,
3BTB
,
4KY9
,
4YZF
,
7TVZ
,
7TW0
,
7TW1
,
7TW2
,
7TW3
,
7TW5
,
7TW6
,
7TY4
,
7TY6
,
7TY7
,
7TY8
,
7TYA
,
7UZ3
,
7UZU
,
7UZV
,
7V07
,
7V0K
,
7V0M
,
7V0T
,
7V0U
,
7V0Y
,
7V19
,
8CRQ
,
8CRR
,
8CRT
,
8CS9
,
8CSL
,
8CSV
,
8CSY
,
8CT3
,
8CTE
,
8T3R
,
8T3U
,
8T44
,
8T45
,
8T47
,
8T6U
,
8T6V
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF07565 |
Band_3_cyto |
86 → 329 |
Band 3 cytoplasmic domain |
Domain |
PF00955 |
HCO3_cotransp |
372 → 566 |
HCO3- transporter family |
Family |
PF00955 |
HCO3_cotransp |
555 → 839 |
HCO3- transporter family |
Family |
|
Sequence |
|
Sequence length |
911 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Anemia |
Anemia, Hemolytic, Anemia, Hemolytic, Acquired, Anemia, Microangiopathic, Anemia, hereditary spherocytic hemolytic, stomatocytic anemia |
rs118204044, rs118204045, rs118204046, rs121918330, rs869320719, rs869312029, rs121918332, rs869320724, rs767094129, rs786205058, rs786205059, rs137853119, rs137853120, rs137853121, rs1384933966, rs137853122, rs137853123, rs786205060, rs267607121, rs121908584, rs80338697, rs80338699, rs120074166, rs120074167, rs1050828, rs74575103, rs137852314, rs5030868, rs137852316, rs137852317, rs137852318, rs137852319, rs137852320, rs137852321, rs137852322, rs137852323, rs137852324, rs72554665, rs387906468, rs5030872, rs137852326, rs137852333, rs137852327, rs137852328, rs137852329, rs137852330, rs137852331, rs137852332, rs137852334, rs137852335, rs137852336, rs137852339, rs76645461, rs137852340, rs137852341, rs78478128, rs137852343, rs137852344, rs137852345, rs587776730, rs137852346, rs137852347, rs137852349, rs2070404412, rs2070350038, rs2070350009, rs137852303, rs137852304, rs33946267, rs34378160, rs33933298, rs11549407, rs35724775, rs34598529, rs41469945, rs267607201, rs80338694, rs80338696, rs387907018, rs398123546, rs78365220, rs587777100, rs587777101, rs483352840, rs869312752, rs765487627, rs1557229599, rs1557230040, rs1555524842, rs782090947, rs1358275550, rs1557229736, rs1557230573, rs1556323334, rs1233124208, rs1293528130, rs146864395, rs1595503440, rs1603411214, rs137852325, rs1575247302, rs1603411177, rs1336651679, rs782322505 |
16227998, 23664421 |
Cholelithiasis |
Cholelithiasis |
rs121918440, rs72552778, rs387906528, rs759202962, rs377160065, rs1051861187, rs757693457, rs752563752 |
|
Dehydrated hereditary stomatocytosis |
Dehydrated hereditary stomatocytosis |
rs774455945, rs1057519076, rs1057519077 |
|
Distal renal tubular acidosis |
Distal Renal Tubular Acidosis, Autosomal dominant distal renal tubular acidosis |
rs121964880, rs769664228, rs121912744, rs121912745, rs121912746, rs121912748, rs121912751, rs878853002, rs781838938, rs782152033, rs1443883930 |
9312167, 9600966, 23460825 |
Elliptocytosis |
Elliptocytosis, Hereditary, Elliptocytosis 4 |
rs121918645, rs863223302, rs863223303, rs1594753904, rs121918647, rs121918648, rs121918650, rs121918634, rs757679761, rs121918637, rs121918638, rs121918640, rs121918641, rs121918642, rs863223305, rs121434564 |
9600966, 1737855, 23664421, 23339107 |
Hereditary spherocytosis |
Hereditary spherocytosis |
rs137852829, rs137852830, rs137852831, rs397514029, rs786205243, rs121918646, rs121918648, rs121918651, rs863223304, rs267607086, rs754614154, rs266257354, rs121917734, rs266257355, rs115998465, rs387906566, rs121912741, rs121912742, rs56361140, rs121912750, rs28931584, rs28931585, rs121912755, rs143682977, rs786204766, rs200386310, rs1553234309, rs1555366607, rs1555366592, rs1553232007, rs1554522035, rs777701149, rs1554567249, rs1554578304, rs1554627073, rs1555367359, rs1555367789, rs150471537, rs1555369657, rs1555370967, rs866727908, rs1555596072, rs1555596165, rs1555596757, rs1586144223, rs1563502820, rs1566754467, rs377659326, rs1594773586, rs1586072383, rs750820522, rs1586145051, rs1594767593, rs1586114714, rs1345709572 |
23664421, 1378323 |
Hyperbilirubinemia |
Hyperbilirubinemia |
rs34993780, rs587784535, rs797046090, rs797046091 |
|
Hypofibrinogenemia |
Hypofibrinogenemia |
rs121913087, rs121913088, rs587776837, rs121909616, rs121909625, rs121909608, rs121909607, rs146387238, rs1578795296, rs1214070111, rs776817952, rs762964798, rs121909606, rs1414035000, rs1310452604 |
|
Pseudohyperkalemia cardiff |
Pseudohyperkalemia Cardiff |
rs754667801, rs764893806 |
16227998, 8547122, 1722314, 9600966 |
Renal tubular acidosis |
Renal Tubular Acidosis, Type II |
rs121908367, rs28939081, rs769664228, rs121912745, rs121912748, rs121912751, rs121912752, rs28931584, rs121912754, rs878853002, rs763982675, rs769164245, rs768446132, rs1443883930, rs754517968, rs1450564765, rs934266733, rs1584907924, rs753232747, rs1584934951 |
9312167, 23460825 |
Renal tubular acidosis, with normal red cell morphology |
Renal Tubular Acidosis, Distal, With Normal Red Cell Morphology |
rs121912753 |
|
Restrictive cardiomyopathy |
Restrictive cardiomyopathy |
rs104894729, rs397516153, rs727503513, rs727503499, rs727503504, rs730880231, rs1554401403, rs1563005534, rs1420394583 |
|
Spherocytosis |
Spherocytosis, Type 4 |
rs786205242, rs786205243, rs786205244, rs121918634 |
9012689, 8547122, 10942416, 7530501, 16227998, 8640229, 15813913, 10580570, 11380459, 10745622, 9973643, 8943874, 9207478, 9600966, 1378323, 1722314, 9233560 |
Thrombophilia |
Thrombophilia |
rs118203912, rs118203911, rs121918141, rs121918142, rs121918143, rs121918144, rs121918145, rs121918146, rs121918147, rs121918148, rs121918149, rs121918151, rs121918152, rs121918153, rs121918154, rs1558715857, rs121918155, rs121918157, rs121918158, rs2104934553, rs121918159, rs121918160, rs121918477, rs121918473, rs121918474, rs267606981, rs2107137679, rs121918475, rs387906674, rs387907201, rs369504169, rs142742242, rs373983977, rs368074804, rs574132670, rs757583846, rs863224838, rs121918476, rs1333329860, rs1553424043, rs1553808038, rs5017717, rs374476971, rs1553809314, rs1553423955, rs767112991, rs1558718572, rs571278160, rs766261022, rs1321566264, rs1559926604, rs1241365457, rs759677822, rs1448630830, rs1305782685, rs1571577365, rs1247269491, rs777486993, rs201907715, rs769277939, rs199469503, rs1575904540, rs199469494, rs199469471, rs1189377845, rs1576182848, rs1688218776, rs1456533664, rs1709033502, rs1708668246, rs1708665916 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Anorexia |
Anorexia |
|
|
Distal renal tubular acidosis with anemia |
Distal renal tubular acidosis with anemia |
|
|
Dwarfism |
Dwarfism |
|
|
Fibrinogen deficiency |
Fibrinogen Deficiency |
|
|
Gout |
Gout |
|
|
Hematological disease |
Hematological Disease |
|
8343110 |
Hereditary cryohydrocytosis with normal stomatin |
Hereditary cryohydrocytosis with normal stomatin |
|
|
Isothenuria |
Isothenuria |
|
|
Microangiopathic hemolytic anemia |
Microangiopathic hemolytic anemia |
|
16227998 |
Nephritis |
Nephritis, Interstitial, Nephritis, Tubulointerstitial |
|
|
Nephrocalcinosis |
Nephrocalcinosis |
|
|
Ovalocytosis |
Ovalocytosis, Malaysian-Melanesian-Filipino Type |
|
1722314, 23664421, 9600966, 23339107, 8547122 |
Periodic hypokalemic paresis |
Periodic hypokalemic paresis |
|
|
Periodic paralysis |
Familial Periodic Paralysis, periodic paralysis (finding) |
|
|
Renal tubular acidosis, distal, with hemolytic anemia |
RENAL TUBULAR ACIDOSIS, DISTAL, WITH HEMOLYTIC ANEMIA (disorder) |
|
9854053, 15211439, 9600966, 10926824 |
Rickets |
Rickets, Adult Rickets |
|
|
Southeast asian ovalocytosis |
Southeast Asian ovalocytosis |
|
|
Xerocytosis |
Xerocytosis |
|
16227998 |
|
|
|