RAG1 (recombination activating 1)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
5896 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Recombination activating 1 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
RAG1 |
SynonymsGene synonyms aliases
|
RAG-1, RNF74 |
ChromosomeChromosome number
|
11 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
11p12 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
The protein encoded by this gene is involved in activation of immunoglobulin V-D-J recombination. The encoded protein is involved in recognition of the DNA substrate, but stable binding and cleavage activity also requires RAG2. Defects in this gene can be |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs28933392 |
G>A |
Pathogenic |
Coding sequence variant, missense variant |
rs104894282 |
G>A,T |
Pathogenic |
Missense variant, coding sequence variant, stop gained |
rs104894283 |
T>G |
Pathogenic |
Coding sequence variant, stop gained |
rs104894284 |
G>A |
Pathogenic |
Missense variant, coding sequence variant |
rs104894285 |
C>T |
Pathogenic |
Missense variant, coding sequence variant |
rs104894286 |
G>A |
Pathogenic, likely-pathogenic |
Missense variant, coding sequence variant |
rs104894287 |
C>G,T |
Pathogenic |
Missense variant, coding sequence variant |
rs104894288 |
A>C |
Pathogenic |
Missense variant, coding sequence variant |
rs104894289 |
C>T |
Pathogenic |
Missense variant, coding sequence variant |
rs104894290 |
A>G |
Pathogenic |
Missense variant, coding sequence variant |
rs104894291 |
G>A,T |
Pathogenic, not-provided |
Missense variant, coding sequence variant |
rs104894292 |
A>G,T |
Pathogenic |
Missense variant, coding sequence variant |
rs104894298 |
C>T |
Pathogenic |
Missense variant, coding sequence variant |
rs121918568 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs121918569 |
G>A |
Pathogenic |
Coding sequence variant, missense variant |
rs121918570 |
C>T |
Uncertain-significance, pathogenic |
Coding sequence variant, missense variant |
rs121918571 |
G>A |
Pathogenic |
Coding sequence variant, missense variant |
rs121918572 |
C>T |
Likely-pathogenic, pathogenic |
Coding sequence variant, missense variant |
rs141524540 |
A>G |
Likely-pathogenic, pathogenic |
Coding sequence variant, missense variant |
rs146457887 |
C>T |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs149229197 |
G>T |
Likely-pathogenic, uncertain-significance |
Missense variant, coding sequence variant |
rs150739647 |
G>A,C |
Pathogenic |
Missense variant, coding sequence variant |
rs193922461 |
G>T |
Pathogenic, pathogenic-likely-pathogenic |
Coding sequence variant, missense variant |
rs193922462 |
C>T |
Uncertain-significance, likely-pathogenic |
Coding sequence variant, missense variant |
rs193922463 |
C>A,G |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs193922464 |
C>G,T |
Pathogenic, likely-pathogenic |
Stop gained, coding sequence variant, missense variant |
rs199474676 |
C>T |
Likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
rs199474680 |
G>A |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
rs199474684 |
G>A |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
rs199474685 |
C>T |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
rs199474686 |
G>A |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
rs199474690 |
A>G,T |
Likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
rs539590514 |
A>G |
Pathogenic |
Missense variant, coding sequence variant |
rs568867325 |
C>G,T |
Pathogenic |
Coding sequence variant, missense variant, stop gained |
rs749223640 |
G>A |
Uncertain-significance, likely-pathogenic |
Coding sequence variant, missense variant |
rs752020152 |
C>A,G,T |
Pathogenic |
Synonymous variant, coding sequence variant, missense variant |
rs754502950 |
C>G |
Pathogenic, likely-pathogenic |
Stop gained, coding sequence variant |
rs755551812 |
A>T |
Likely-pathogenic |
Stop gained, coding sequence variant |
rs757797994 |
C>T |
Pathogenic |
Coding sequence variant, stop gained |
rs764981110 |
C>T |
Pathogenic, likely-pathogenic |
Missense variant, coding sequence variant |
rs768860215 |
G>T |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs772340017 |
A>G |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs772962160 |
AA>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs773929270 |
C>T |
Pathogenic |
Coding sequence variant, stop gained |
rs775412266 |
A>G |
Uncertain-significance, likely-pathogenic |
Coding sequence variant, missense variant |
rs786205615 |
G>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
rs878853004 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs878853031 |
A>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs886041745 |
->A |
Pathogenic, benign |
Frameshift variant, coding sequence variant |
rs902350422 |
T>A |
Pathogenic |
Coding sequence variant, stop gained |
rs1064793248 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs1064793249 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs1241698978 |
T>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1554944856 |
G>T |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1564988767 |
C>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1564988958 |
A>G |
Pathogenic |
Coding sequence variant, missense variant |
rs1564989420 |
G>C |
Pathogenic |
Coding sequence variant, missense variant |
rs1564989455 |
G>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1564989610 |
G>C |
Pathogenic |
Coding sequence variant, missense variant |
rs1564989655 |
T>C |
Pathogenic |
Coding sequence variant, missense variant |
rs1590701881 |
TGATGAGC>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1590702629 |
G>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1590702729 |
GTCTTGAATTCCCTGATGGTGAAATGTC>AAAAGAGTG |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1590702874 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs1590703275 |
C>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1590703740 |
A>C |
Likely-pathogenic |
Coding sequence variant, missense variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Transcription factors
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P15918 |
Protein name |
V(D)J recombination-activating protein 1 (RAG-1) (RING finger protein 74) [Includes: Endonuclease RAG1 (EC 3.1.-.-); E3 ubiquitin-protein ligase RAG1 (EC 2.3.2.27) (RING-type E3 ubiquitin transferase RAG1)] |
Protein function |
Catalytic component of the RAG complex, a multiprotein complex that mediates the DNA cleavage phase during V(D)J recombination. V(D)J recombination assembles a diverse repertoire of immunoglobulin and T-cell receptor genes in developing B and T- |
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF12560 |
RAG1_imp_bd |
11 → 291 |
RAG1 importin binding |
Family |
PF13923 |
zf-C3HC4_2 |
292 → 331 |
|
Domain |
PF10426 |
zf-RAG1 |
354 → 383 |
Recombination-activating protein 1 zinc-finger domain |
Domain |
PF12940 |
RAG1 |
384 → 1028 |
Recombination-activation protein 1 (RAG1), recombinase |
Family |
|
Sequence |
|
Sequence length |
1043 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Anemia |
Anemia |
rs118204044, rs118204045, rs118204046, rs121918330, rs869320719, rs869312029, rs121918332, rs869320724, rs767094129, rs786205058, rs786205059, rs137853119, rs137853120, rs137853121, rs1384933966, rs137853122, rs137853123, rs786205060, rs267607121, rs121908584, rs80338697, rs80338699, rs120074166, rs120074167, rs1050828, rs74575103, rs137852314, rs5030868, rs137852316, rs137852317, rs137852318, rs137852319, rs137852320, rs137852321, rs137852322, rs137852323, rs137852324, rs72554665, rs387906468, rs5030872, rs137852326, rs137852333, rs137852327, rs137852328, rs137852329, rs137852330, rs137852331, rs137852332, rs137852334, rs137852335, rs137852336, rs137852339, rs76645461, rs137852340, rs137852341, rs78478128, rs137852343, rs137852344, rs137852345, rs587776730, rs137852346, rs137852347, rs137852349, rs2070404412, rs2070350038, rs2070350009, rs137852303, rs137852304, rs33946267, rs34378160, rs33933298, rs11549407, rs35724775, rs34598529, rs41469945, rs267607201, rs80338694, rs80338696, rs387907018, rs398123546, rs78365220, rs587777100, rs587777101, rs483352840, rs869312752, rs765487627, rs1557229599, rs1557230040, rs1555524842, rs782090947, rs1358275550, rs1557229736, rs1557230573, rs1556323334, rs1233124208, rs1293528130, rs146864395, rs1595503440, rs1603411214, rs137852325, rs1575247302, rs1603411177, rs1336651679, rs782322505 |
|
Arthritis |
Arthritis |
rs1594890601, rs1594882933, rs184370809, rs776489319, rs1594883470 |
|
Hypothyroidism |
Hypothyroidism |
rs869320723, rs121908862, rs121908863, rs121908865, rs121908866, rs121908867, rs121908870, rs121908871, rs121908872, rs2140110277, rs121908881, rs121908884, rs121908885, rs786205080, rs1586182912, rs121917847, rs104893655, rs104893657, rs104893658, rs104893659, rs104893660, rs104893656, rs121917719, rs786204790, rs189261858, rs879255608, rs868197660, rs879255609, rs1586744173, rs1586182837, rs771222349, rs1587618417, rs1601844140, rs760832986, rs780982673, rs1603336347, rs1691155605 |
|
Lymphoma |
Lymphoma |
rs11540652, rs1592119138, rs1592123162, rs1599367044 |
|
Nephrotic syndrome |
Nephrotic Syndrome |
rs876657369, rs121912601, rs121912602, rs876657370, rs121912603, rs121912604, rs121912605, rs121907900, rs121907901, rs28941778, rs587776576, rs28942089, rs587776577, rs28941777, rs121907910, rs1568296260, rs119473033, rs74315342, rs74315343, rs74315345, rs74315346, rs74315347, rs74315348, rs121434394, rs267606919, rs121912488, rs267606953, rs267606954, rs267606955, rs104886210, rs1591732280, rs1591750243, rs140511594, rs140781106, rs147972030, rs587776969, rs386833863, rs386833880, rs386833882, rs386833892, rs386833895, rs386833909, rs386833911, rs386833920, rs386833935, rs386833947, rs1555763603, rs398122978, rs398122979, rs398122980, rs369573693, rs398122981, rs398122982, rs398122983, rs200482683, rs730882194, rs180177201, rs587777552, rs587777553, rs775170915, rs749740335, rs12568913, rs530318579, rs786204583, rs786204708, rs786204632, rs138656762, rs797044992, rs797044994, rs797044995, rs864321632, rs864321687, rs864321688, rs864321633, rs869025495, rs869025541, rs869312747, rs145473779, rs757674160, rs869320695, rs138909849, rs869312984, rs1057516900, rs763818901, rs199506378, rs1057517164, rs1057516523, rs1057516414, rs778055996, rs1057516395, rs1057516747, rs1057516880, rs1057516680, rs778217926, rs1057519347, rs764587648, rs1060499703, rs121907903, rs769259446, rs1131692252, rs1131692253, rs1131692254, rs1131692255, rs1131692256, rs746887949, rs1131692235, rs1135402911, rs1135402912, rs1135402913, rs1554946480, rs1555331969, rs773173317, rs1555816634, rs775006954, rs1320543506, rs534522842, rs1272948499, rs1191455921, rs1291398331, rs1554939785, rs776016942, rs1031744496, rs748812981, rs755972674, rs1553312833, rs967339926, rs1462028977, rs1212702104, rs1167223941, rs762631237, rs1553316575, rs1553315173, rs1553316648, rs1553316611, rs780761368, rs368572297, rs1568070817, rs1321552081, rs1558108130, rs1558091788, rs1565707103, rs1558355124, rs1564622701, rs1351580598, rs1589475328, rs1589413498, rs1572255744, rs1572262824, rs761410195, rs1602413491, rs1590326226, rs375998390, rs570583897, rs369363545, rs201488687, rs1334894971, rs763782471, rs138047529, rs895782232, rs1572255047, rs1589433172, rs1589509476, rs1572277600, rs1572282458, rs1584675898, rs759043857, rs1853443391 |
|
Immunodeficiency |
Primary immune deficiency disorder |
rs1565678077, rs121908002, rs1421444086, rs1565688667, rs944235493, rs121918314, rs587776713, rs137852678, rs587776714, rs128620188, rs2147483647, rs1569556522, rs137853331, rs137853332, rs179363866, rs483352928, rs121918659, rs111033580, rs111033581, rs74315290, rs193922740, rs193922741, rs104894199, rs483352927, rs104894286, rs1571865049, rs886041032, rs2069709, rs587776822, rs74315444, rs587776823, rs1315265916, rs104893893, rs104893894, rs121434560, rs387906572, rs587776853, rs104893973, rs587776854, rs587776855, rs587776857, rs104893974, rs121912715, rs1393707607, rs113994136, rs387906593, rs587776870, rs387906763, rs387906913, rs199469663, rs199469662, rs199469664, rs193922640, rs193922641, rs193922645, rs398122890, rs387907316, rs397514710, rs398122383, rs397515453, rs397514332, rs398123058, rs397518423, rs587777075, rs199676861, rs77563738, rs587777337, rs28730670, rs587777389, rs587777390, rs587777413, rs587777414, rs587777415, rs587777416, rs267608260, rs267608261, rs587778405, rs587777446, rs587777562, rs587777564, rs587777565, rs869320745, rs587777709, rs606231305, rs672601318, rs727503779, rs727503780, rs730880296, rs786200953, rs375323253, rs794729666, rs886041037, rs886041038, rs796051887, rs796051888, rs749956849, rs199641706, rs775739391, rs869312886, rs869312857, rs879253731, rs879253732, rs201025290, rs770927552, rs878853275, rs878853276, rs878853277, rs878853278, rs1567506566, rs886037920, rs886037921, rs750610248, rs200044623, rs886043118, rs886060531, rs1057519074, rs1057519075, rs1057518744, rs1057519079, rs1057518745, rs1057518746, rs1057518747, rs782178147, rs55729925, rs1064795762, rs1064794957, rs1085307649, rs745463649, rs773694113, rs1192554889, rs779575307, rs1554051075, rs1554051067, rs1554051033, rs1554067182, rs1555167566, rs1555169270, rs1555908409, rs1555719963, rs1554064929, rs768091235, rs1404084330, rs144104577, rs1553238837, rs1553243550, rs1554020278, rs1554066684, rs762678772, rs570768621, rs1443126481, rs1553721236, rs121434258, rs888230251, rs1759915032, rs1759514836, rs138156467, rs1560914625, rs755373718, rs1561423197, rs1560938296, rs200803157, rs766555082, rs201543770, rs114951157, rs775578531, rs201128237, rs778624945, rs1563340753, rs1561772403, rs1484948342, rs777878144, rs1562364898, rs1561254290, rs1569296295, rs1568815169, rs1568822574, rs1571880832, rs934523851, rs1922072844, rs1266114717, rs137869655, rs869320689, rs1571880941, rs1580875488, rs1581303476, rs1448018291, rs1390410878, rs774803573, rs1591278347, rs1602300615, rs1601340933, rs757598952, rs1181595292, rs1408683294, rs1595843113, rs1595848141, rs779560450, rs1595816926, rs1601861196, rs1601861199, rs756541321, rs1594389703, rs1594390415, rs1581401865, rs1236009877, rs753213766, rs778993919, rs1602878106, rs141698985, rs1264504989, rs1580974401, rs2093571190, rs530286781, rs2086875746, rs2089298923, rs1206185362, rs1581573705, rs1596718225, rs1004337827, rs1573613529, rs1574636674, rs1574657735, rs1574657762, rs1574672718, rs1581573640, rs1553657429, rs200666300, rs1578735747, rs1578771211, rs1578793312, rs1578795536, rs1578809101, rs1578811073, rs1578811245, rs1171694504, rs1578971328, rs140800288, rs374333820, rs1584926133, rs1585040113, rs1584409386, rs1379376784, rs1586940273, rs1587143342, rs748910652, rs1592117677, rs758555433, rs1596712783, rs34019455, rs147766868, rs751386365, rs1600631294, rs1489114116, rs1057520578, rs1603007888, rs1603008329, rs1574450161, rs1578735709, rs1403833564, rs1580262965, rs570910902, rs1589866171, rs1578999313, rs1582635229, rs1582637044, rs1580851910, rs1750760771, rs745453685, rs1249197356, rs201840561, rs1940921909, rs1941410085, rs1941465194, rs1321690789, rs1302362911, rs1730552437, rs2052705192, rs1941856970 |
12200379, 16960852, 10891502, 26457731, 19470080, 21131235, 22841008 |
Prostate cancer |
Malignant neoplasm of prostate |
rs121909139, rs121909140, rs121909141, rs121909142, rs121909143, rs606231169, rs606231170, rs137852584, rs137852578, rs137852580, rs137852581, rs137852582 |
29610475 |
Severe combined immunodeficiency disease |
Severe Combined Immunodeficiency, Combined immunodeficiency, Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Negative, NK Cell-Positive, Severe combined immunodeficiency due to complete RAG1/2 deficiency |
rs886037607, rs118203993, rs121908714, rs121908739, rs121908740, rs121908735, rs121908721, rs121908722, rs121908156, rs1564414523, rs1564418254, rs1564446526, rs786205074, rs121908157, rs121908159, rs786200884, rs397515357, rs104894562, rs137852624, rs137852625, rs137852626, rs137852627, rs137852507, rs137852509, rs111033619, rs111033620, rs1569480018, rs111033621, rs137852510, rs587776729, rs111033622, rs111033617, rs111033618, rs121917894, rs121917896, rs2133313409, rs121917897, rs28933392, rs104894282, rs104894283, rs104894285, rs121918570, rs121918572, rs730880318, rs104893674, rs730880319, rs104894453, rs104894454, rs104894451, rs137853206, rs777503956, rs267606645, rs267606648, rs397515390, rs193922346, rs193922347, rs193922348, rs193922349, rs193922350, rs137852508, rs193922640, rs193922641, rs193922643, rs193922645, rs193922361, rs193922364, rs193922464, rs148508754, rs193922574, rs113994174, rs606231246, rs397514671, rs397514686, rs397514755, rs199474679, rs199474685, rs199474686, rs199474681, rs150739647, rs267605358, rs886041036, rs587777335, rs587778405, rs145092287, rs587777562, rs606231256, rs200296680, rs786205456, rs786205517, rs774202259, rs786205615, rs878853261, rs786205890, rs782753385, rs746052951, rs869025224, rs869312857, rs869320660, rs869320659, rs869320658, rs879253742, rs886037924, rs886037925, rs750610248, rs886039394, rs761242509, rs886039387, rs886041043, rs886041044, rs886042051, rs886041333, rs749481781, rs1057517747, rs1057519506, rs1057523762, rs1057521062, rs1057520644, rs761583890, rs751635016, rs55729925, rs1064793248, rs1064793347, rs1064794027, rs781410769, rs1555524788, rs1486760100, rs769633203, rs1556330713, rs1555322558, rs1556330234, rs1556330755, rs1556329779, rs1556330552, rs1556329822, rs1556330286, rs1556331272, rs2146178281, rs376610445, rs757797994, rs775704953, rs1555743321, rs1564995660, rs1564995662, rs1556330249, rs144104577, rs886041796, rs1026474882, rs570768621, rs1556330562, rs1556330568, rs780014431, rs778343059, rs1555844617, rs1567629968, rs1567628757, rs1567629943, rs1567632864, rs1567632829, rs1567626023, rs1559328006, rs1561423197, rs1452483770, rs1568400897, rs1569479913, rs1568404443, rs1569480047, rs1563340753, rs368303189, rs1568431262, rs1568431102, rs1561424886, rs1602289943, rs1241698978, rs1569479994, rs1569480082, rs1602289649, rs1573261820, rs770985198, rs1589050343, rs1340132582, rs1589064324, rs1589070600, rs1213680890, rs149316157, rs1599873591, rs755706305, rs1602288051, rs1602289411, rs1602289183, rs1583513256, rs1589136659, rs1380154594, rs1011307501, rs1599876167, rs1569967422, rs1602289631, rs1573262398, rs760191638, rs1592117677, rs1640406042, rs372597855, rs1839558393, rs1839622622, rs1839957089, rs777008519, rs1233957241, rs2092261618, rs1839255008, rs1677695565, rs936493226, rs1162344514, rs991089005 |
18768869, 11213808, 20956421, 18463379, 11971977, 27484032, 17572155, 25869295, 10701853, 8810255, 9630231, 11133745, 18822103, 19458910, 25516070, 18056378, 19064334, 11313270, 18701881, 18442948, 20489056, 21131235, 24290284, 19830075, 19912631, 17572155, 17075247 |
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Alopecia |
Alopecia |
|
|
Autoimmune hemolytic anemia |
Autoimmune hemolytic anemia |
|
|
Combined cellular and humoral immune defects with granulomas |
Combined Cellular And Humoral Immune Defects With Granulomas, Combined immunodeficiency with granulomatosis |
|
11133745, 17075247, 18822103, 19458910, 18701881, 18463379, 20489056, 10701853, 19064334, 11313270, 25516070, 18056378, 19830075, 24290284, 18442948, 17572155, 21131235, 9630231 |
Congenital hypoplasia of thymus |
Congenital hypoplasia of thymus |
|
|
Conjunctivitis |
Conjunctivitis |
|
|
Eosinophilia |
Eosinophilia |
|
|
Exfoliative dermatitis |
Exfoliative dermatitis |
|
|
Hypoproteinemia |
Hypoproteinemia |
|
|
Immunologic deficiency syndromes |
Immunologic Deficiency Syndromes |
|
|
Lymphadenitis |
Lymphadenitis |
|
|
Mastoiditis |
Mastoiditis |
|
|
Omenn syndrome |
Omenn Syndrome |
|
16960852, 21131235, 21771083, 9630231, 19470080, 11133745, 11908269, 21664875, 19912631, 10891502, 26457731, 12200379, 22841008, 20956421, 17075247, 11971977, 10606976, 17176792, 21624848 |
Otitis media |
Otitis Media |
rs601338, rs1047781, rs1800028 |
|
Prostatic neoplasms |
Prostatic Neoplasms |
|
29610475 |
Reticuloendotheliosis with eosinophilia |
Reticuloendotheliosis, familial, with eosinophilia |
|
|
Thyroiditis |
Thyroiditis |
|
|
|
|
|