SPTBN4 (spectrin beta, non-erythrocytic 4)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
57731 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Spectrin beta, non-erythrocytic 4 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
SPTBN4 |
SynonymsGene synonyms aliases
|
CMND, NEDHND, QV, SPNB4, SPTBN3 |
ChromosomeChromosome number
|
19 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
19q13.2 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is compo |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs765087147 |
G>A |
Pathogenic |
Genic upstream transcript variant, missense variant, coding sequence variant |
rs777273785 |
C>A,T |
Pathogenic |
Missense variant, intron variant, coding sequence variant, genic downstream transcript variant |
rs864309618 |
G>A |
Uncertain-significance, pathogenic |
Genic upstream transcript variant, coding sequence variant, stop gained |
rs1114167445 |
C>T |
Pathogenic |
Coding sequence variant, stop gained, genic upstream transcript variant |
rs1555721549 |
G>- |
Pathogenic |
Frameshift variant, coding sequence variant, downstream transcript variant, genic downstream transcript variant |
rs1555815437 |
->AGCGGGCGGCGCGCATGACC |
Likely-pathogenic |
Genic upstream transcript variant, coding sequence variant, frameshift variant |
rs1555818396 |
G>T |
Pathogenic |
Genic upstream transcript variant, coding sequence variant, stop gained |
rs1599759068 |
GC>- |
Likely-pathogenic |
Genic upstream transcript variant, coding sequence variant, frameshift variant |
rs1599794560 |
G>T |
Likely-pathogenic |
Splice donor variant, genic downstream transcript variant |
rs1599819198 |
->ATGAGGCC |
Likely-pathogenic |
Frameshift variant, coding sequence variant, genic downstream transcript variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
Q9H254 |
Protein name |
Spectrin beta chain, non-erythrocytic 4 (Beta-IV spectrin) (Spectrin, non-erythroid beta chain 3) |
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF00307 |
CH |
61 → 166 |
Calponin homology (CH) domain |
Domain |
PF00307 |
CH |
180 → 286 |
Calponin homology (CH) domain |
Domain |
PF00435 |
Spectrin |
309 → 419 |
Spectrin repeat |
Domain |
PF00435 |
Spectrin |
429 → 533 |
Spectrin repeat |
Domain |
PF00435 |
Spectrin |
535 → 642 |
Spectrin repeat |
Domain |
PF00435 |
Spectrin |
773 → 879 |
Spectrin repeat |
Domain |
PF00435 |
Spectrin |
881 → 985 |
Spectrin repeat |
Domain |
PF00435 |
Spectrin |
1088 → 1197 |
Spectrin repeat |
Domain |
PF00435 |
Spectrin |
1305 → 1408 |
Spectrin repeat |
Domain |
PF00435 |
Spectrin |
1410 → 1513 |
Spectrin repeat |
Domain |
PF00435 |
Spectrin |
1515 → 1619 |
Spectrin repeat |
Domain |
PF00435 |
Spectrin |
1622 → 1725 |
Spectrin repeat |
Domain |
PF00435 |
Spectrin |
1727 → 1832 |
Spectrin repeat |
Domain |
PF00435 |
Spectrin |
1834 → 1939 |
Spectrin repeat |
Domain |
PF00435 |
Spectrin |
1942 → 2046 |
Spectrin repeat |
Domain |
PF00435 |
Spectrin |
2048 → 2127 |
Spectrin repeat |
Domain |
PF15410 |
PH_9 |
2420 → 2527 |
Pleckstrin homology domain |
Domain |
|
Sequence |
|
Sequence length |
2564 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Developmental delay |
Global developmental delay |
rs28941770, rs199469464, rs281865469, rs143747297, rs398123009, rs587777428, rs786205133, rs606231459, rs797044854, rs797045027, rs864309504, rs878853160, rs886039902, rs886042046, rs886041291, rs886041382, rs1057518991, rs1057518699, rs753254213, rs748294403, rs762552974, rs1135401795, rs1553121073, rs1553122926, rs1364690005, rs1554086554, rs1554210415, rs1554168326, rs1554776342, rs1553873247, rs1567860112, rs779009256, rs1557447255, rs1564568350, rs780011005, rs1597464953, rs1200336864, rs1569513017, rs1587459606, rs1570332505, rs748888652, rs1575155995, rs2087029320, rs1589669105, rs1601769604, rs1184981709, rs749201074 |
|
Neurodevelopmental disorder with hypotonia, neuropathy, and deafness |
NEURODEVELOPMENTAL DISORDER WITH HYPOTONIA, NEUROPATHY, AND DEAFNESS |
rs1114167445, rs1555818396, rs777273785, rs1555721549, rs1599794560 |
28540413 |
Papillary renal carcinoma |
Papillary Renal Cell Carcinoma |
rs5030823, rs2137087134, rs121913668, rs121913669, rs121913670, rs121913671, rs121913673, rs121913243, rs786202724 |
22138691 |
Renal carcinoma |
Renal Cell Carcinoma, Conventional (Clear Cell) Renal Cell Carcinoma, Sarcomatoid Renal Cell Carcinoma, Collecting Duct Carcinoma of the Kidney |
rs121913668, rs121913670, rs121913243, rs786202724 |
22138691 |
Scoliosis |
Scoliosis, unspecified |
rs1057518828, rs147296805, rs758163506, rs1555613564, rs1596852902, rs1596853067, rs1596853085 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Amyotrophy |
Generalized amyotrophy |
|
|
Central visual impairment |
Central visual impairment |
|
|
Chromophobe carcinoma |
Chromophobe Renal Cell Carcinoma |
rs137853247 |
22138691 |
Demyelinating neuropathy |
Peripheral demyelinating neuropathy |
|
|
Distal amyotrophy |
Distal amyotrophy |
rs1457770815 |
|
Facial paralysis |
Facial paralysis |
|
|
High palate |
Byzanthine arch palate |
|
|
Sclerocystic ovaries |
Sclerocystic Ovaries |
|
21411543 |
Polycystic ovary syndrome |
Polycystic Ovary Syndrome |
|
21411543 |
|
|
|
| © 2021, Biomedical Informatics Centre, NIRRH |
ICMR-National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400012
Tel: +91-22-24192104, Fax No: +91-22-24139412 |