PRNP (prion protein (Kanno blood group))
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
5621 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Prion protein (Kanno blood group) |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
PRNP |
SynonymsGene synonyms aliases
|
ASCR, AltPrP, CD230, CJD, GSS, KURU, PRIP, PrP, PrP27-30, PrP33-35C, PrPc, p27-30 |
ChromosomeChromosome number
|
20 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
20p13 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is foun |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs1799990 |
A>G |
Risk-factor, pathogenic, benign |
Missense variant, coding sequence variant, 3 prime UTR variant |
rs11538758 |
C>A,T |
Pathogenic |
Missense variant, coding sequence variant, 3 prime UTR variant |
rs17852079 |
C>A,T |
Pathogenic |
Missense variant, coding sequence variant, 3 prime UTR variant, stop gained |
rs28933385 |
G>A |
Pathogenic |
Missense variant, coding sequence variant, 3 prime UTR variant |
rs74315401 |
C>T |
Pathogenic |
Coding sequence variant, missense variant, synonymous variant |
rs74315402 |
C>T |
Pathogenic |
Coding sequence variant, 3 prime UTR variant, missense variant |
rs74315403 |
G>A |
Pathogenic |
Coding sequence variant, 3 prime UTR variant, missense variant |
rs74315405 |
T>C |
Pathogenic |
Coding sequence variant, 3 prime UTR variant, missense variant |
rs74315406 |
A>G |
Pathogenic |
Coding sequence variant, 3 prime UTR variant, missense variant |
rs74315407 |
G>A |
Pathogenic |
Coding sequence variant, 3 prime UTR variant, missense variant |
rs74315408 |
G>A |
Likely-pathogenic, pathogenic |
Coding sequence variant, 3 prime UTR variant, missense variant |
rs74315409 |
T>G |
Uncertain-significance, pathogenic |
Coding sequence variant, 3 prime UTR variant, missense variant |
rs74315410 |
G>T |
Pathogenic |
Coding sequence variant, 3 prime UTR variant, missense variant |
rs74315411 |
A>G |
Pathogenic |
Coding sequence variant, 3 prime UTR variant, missense variant |
rs74315412 |
G>A |
Uncertain-significance, pathogenic |
Coding sequence variant, 3 prime UTR variant, missense variant |
rs74315413 |
A>G |
Pathogenic |
Coding sequence variant, 3 prime UTR variant, missense variant |
rs74315414 |
C>A,T |
Pathogenic |
Coding sequence variant, 3 prime UTR variant, missense variant |
rs74315415 |
C>T |
Pathogenic |
Coding sequence variant, 3 prime UTR variant, missense variant |
rs80356710 |
T>G |
Pathogenic |
Stop gained, coding sequence variant, 3 prime UTR variant |
rs80356711 |
C>T |
Pathogenic |
Stop gained, coding sequence variant, 3 prime UTR variant |
rs193922906 |
TCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC>-,TCATGGTGGTGGCTGGGGGCAGCC,TCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC,TCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC,TCATGGTGG |
Pathogenic, likely-benign, benign |
Inframe insertion, coding sequence variant, inframe deletion |
rs398122370 |
G>C |
Pathogenic |
Coding sequence variant, missense variant, 3 prime UTR variant |
rs398122413 |
G>C |
Pathogenic |
Coding sequence variant, missense variant, 3 prime UTR variant |
rs398122414 |
C>A |
Pathogenic |
Coding sequence variant, 3 prime UTR variant, stop gained |
rs1555782101 |
C>G |
Pathogenic |
Stop gained, coding sequence variant, 3 prime UTR variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Transcription factors
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
GO ID |
Ontology |
Definition |
Evidence |
Reference |
GO:0001540 |
Function |
Amyloid-beta binding |
IDA |
24012003 |
GO:0001540 |
Function |
Amyloid-beta binding |
IPI |
22820466 |
GO:0001540 |
Function |
Amyloid-beta binding |
ISS |
|
GO:0001540 |
Function |
Amyloid-beta binding |
TAS |
21593310, 26871627 |
GO:0001933 |
Process |
Negative regulation of protein phosphorylation |
ISS |
|
GO:0002020 |
Function |
Protease binding |
ISS |
|
GO:0005507 |
Function |
Copper ion binding |
IDA |
11900542 |
GO:0005507 |
Function |
Copper ion binding |
TAS |
16294306, 19242475, 24970228 |
GO:0005509 |
Function |
Calcium ion binding |
IBA |
21873635 |
GO:0005515 |
Function |
Protein binding |
IPI |
16286452, 17500595, 18482256, 21920025, 22285492, 22484317, 23236467, 23907583, 24028865, 28298427, 28650319, 28671123, 32814053 |
GO:0005539 |
Function |
Glycosaminoglycan binding |
ISS |
|
GO:0005634 |
Component |
Nucleus |
IBA |
21873635 |
GO:0005737 |
Component |
Cytoplasm |
IBA |
21873635 |
GO:0005737 |
Component |
Cytoplasm |
TAS |
16004966 |
GO:0005783 |
Component |
Endoplasmic reticulum |
ISS |
|
GO:0005794 |
Component |
Golgi apparatus |
ISS |
|
GO:0005829 |
Component |
Cytosol |
IDA |
|
GO:0005886 |
Component |
Plasma membrane |
IDA |
16254249, 18419754 |
GO:0005886 |
Component |
Plasma membrane |
ISS |
|
GO:0006878 |
Process |
Cellular copper ion homeostasis |
NAS |
16004966 |
GO:0006979 |
Process |
Response to oxidative stress |
ISS |
|
GO:0007050 |
Process |
Cell cycle arrest |
IEA |
|
GO:0007611 |
Process |
Learning or memory |
ISS |
|
GO:0007616 |
Process |
Long-term memory |
TAS |
19242475 |
GO:0008017 |
Function |
Microtubule binding |
IDA |
16004966 |
GO:0009986 |
Component |
Cell surface |
HDA |
19581412 |
GO:0009986 |
Component |
Cell surface |
IDA |
18419754 |
GO:0010951 |
Process |
Negative regulation of endopeptidase activity |
IEA |
|
GO:0010955 |
Process |
Negative regulation of protein processing |
TAS |
23386614 |
GO:0014069 |
Component |
Postsynaptic density |
ISS |
|
GO:0014069 |
Component |
Postsynaptic density |
TAS |
22820466 |
GO:0015631 |
Function |
Tubulin binding |
IDA |
16004966 |
GO:0016234 |
Component |
Inclusion body |
IMP |
20564047 |
GO:0019828 |
Function |
Aspartic-type endopeptidase inhibitor activity |
ISS |
|
GO:0019898 |
Component |
Extrinsic component of membrane |
TAS |
16004966 |
GO:0030425 |
Component |
Dendrite |
IDA |
24012003 |
GO:0031362 |
Component |
Anchored component of external side of plasma membrane |
NAS |
22293988 |
GO:0031648 |
Process |
Protein destabilization |
IMP |
20564047 |
GO:0031802 |
Function |
Type 5 metabotropic glutamate receptor binding |
IPI |
24012003 |
GO:0031802 |
Function |
Type 5 metabotropic glutamate receptor binding |
ISS |
|
GO:0031805 |
Function |
Type 8 metabotropic glutamate receptor binding |
IDA |
24012003 |
GO:0031965 |
Component |
Nuclear membrane |
IDA |
|
GO:0032689 |
Process |
Negative regulation of interferon-gamma production |
ISS |
|
GO:0032700 |
Process |
Negative regulation of interleukin-17 production |
ISS |
|
GO:0032703 |
Process |
Negative regulation of interleukin-2 production |
ISS |
|
GO:0035584 |
Process |
Calcium-mediated signaling using intracellular calcium source |
IGI |
24012003 |
GO:0038023 |
Function |
Signaling receptor activity |
ISS |
|
GO:0042802 |
Function |
Identical protein binding |
IPI |
16286452, 18025469, 18436646, 19204296, 19278656, 19927125, 20564047, 21920025, 32284600, 32514176 |
GO:0043231 |
Component |
Intracellular membrane-bounded organelle |
IDA |
|
GO:0043433 |
Process |
Negative regulation of DNA-binding transcription factor activity |
ISS |
|
GO:0043525 |
Process |
Positive regulation of neuron apoptotic process |
IMP |
20564047 |
GO:0044877 |
Function |
Protein-containing complex binding |
IPI |
23386614 |
GO:0044877 |
Function |
Protein-containing complex binding |
ISS |
|
GO:0045121 |
Component |
Membrane raft |
IDA |
16254249 |
GO:0045121 |
Component |
Membrane raft |
IMP |
23386614 |
GO:0045121 |
Component |
Membrane raft |
ISS |
|
GO:0046007 |
Process |
Negative regulation of activated T cell proliferation |
ISS |
|
GO:0050730 |
Process |
Regulation of peptidyl-tyrosine phosphorylation |
ISS |
|
GO:0050731 |
Process |
Positive regulation of peptidyl-tyrosine phosphorylation |
IDA |
22820466 |
GO:0050860 |
Process |
Negative regulation of T cell receptor signaling pathway |
ISS |
|
GO:0051260 |
Process |
Protein homooligomerization |
IEA |
|
GO:0061098 |
Process |
Positive regulation of protein tyrosine kinase activity |
IGI |
24012003 |
GO:0070062 |
Component |
Extracellular exosome |
HDA |
19056867 |
GO:0070885 |
Process |
Negative regulation of calcineurin-NFAT signaling cascade |
ISS |
|
GO:0071280 |
Process |
Cellular response to copper ion |
IDA |
16254249 |
GO:0090314 |
Process |
Positive regulation of protein targeting to membrane |
ISS |
|
GO:0090647 |
Process |
Modulation of age-related behavioral decline |
ISS |
|
GO:0097062 |
Process |
Dendritic spine maintenance |
TAS |
25707991 |
GO:0098794 |
Component |
Postsynapse |
TAS |
26224839 |
GO:1900449 |
Process |
Regulation of glutamate receptor signaling pathway |
ISS |
|
GO:1901216 |
Process |
Positive regulation of neuron death |
ISS |
|
GO:1902430 |
Process |
Negative regulation of amyloid-beta formation |
ISS |
|
GO:1902938 |
Process |
Regulation of intracellular calcium activated chloride channel activity |
IGI |
24012003 |
GO:1902951 |
Process |
Negative regulation of dendritic spine maintenance |
ISS |
|
GO:1902992 |
Process |
Negative regulation of amyloid precursor protein catabolic process |
ISS |
|
GO:1903136 |
Function |
Cuprous ion binding |
IMP |
20564047 |
GO:1904645 |
Process |
Response to amyloid-beta |
ISS |
|
GO:1904646 |
Process |
Cellular response to amyloid-beta |
IGI |
24012003 |
GO:1905664 |
Process |
Regulation of calcium ion import across plasma membrane |
ISS |
|
GO:1990535 |
Process |
Neuron projection maintenance |
ISS |
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P04156 |
Protein name |
Major prion protein (PrP) (ASCR) (PrP27-30) (PrP33-35C) (CD antigen CD230) |
Protein function |
Its primary physiological function is unclear. May play a role in neuronal development and synaptic plasticity. May be required for neuronal myelin sheath maintenance. May promote myelin homeostasis through acting as an agonist for ADGRG6 recept |
PDB |
1E1G
,
1E1J
,
1E1P
,
1E1S
,
1E1U
,
1E1W
,
1FKC
,
1FO7
,
1H0L
,
1HJM
,
1HJN
,
1I4M
,
1OEH
,
1OEI
,
1QLX
,
1QLZ
,
1QM0
,
1QM1
,
1QM2
,
1QM3
,
2IV4
,
2IV5
,
2IV6
,
2K1D
,
2KUN
,
2LBG
,
2LEJ
,
2LFT
,
2LSB
,
2LV1
,
2M8T
,
2OL9
,
2W9E
,
3HAF
,
3HAK
,
3HEQ
,
3HER
,
3HES
,
3HJ5
,
3HJX
,
3MD4
,
3MD5
,
3NHC
,
3NHD
,
3NVF
,
4DGI
,
4E1H
,
4E1I
,
4KML
,
4N9O
,
5L6R
|
UniProt ID |
F7VJQ1 |
Protein name |
Alternative prion protein (AltPrP) |
Family and domains |
|
Sequence |
MEHWGQPIPGAGQPWRQPLPTSGRWWLGAASWWWLGAASWWWLGAAPWWWLGTASWWWLG SRRWHPQSVEQAE
|
|
Sequence length |
73 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Action myoclonus-renal failure syndrome |
Action Myoclonus-Renal Failure Syndrome |
rs727502772, rs727502773, rs121909118, rs121909119, rs727502781, rs727502782, rs200053119, rs886041078, rs886041077, rs886041076, rs886041075, rs995674389, rs1553948516, rs1578733075 |
25401298 |
Alzheimer disease |
Familial Alzheimer Disease (FAD), Alzheimer Disease, Late Onset, Alzheimer Disease, Early Onset, Alzheimer`s Disease, Alzheimer`s Disease, Focal Onset |
rs63750215, rs28936379, rs63749851, rs63749884, rs28936380, rs63750048, rs63750579, rs63750264, rs63749964, rs63750671, rs281865161, rs63750066, rs63750399, rs63750734, rs63751039, rs63750973, rs63749810, rs63750643, rs193922916, rs63750306, rs63750590, rs63750526, rs63751235, rs661, rs63751037, rs63749885, rs63750231, rs63751229, rs63751272, rs63751223, rs63750391, rs63751163, rs281875357, rs63751141, rs63750082, rs121917807, rs63751399, rs63750265, rs63751144, rs63750886, rs63751068, rs121917808, rs63749891, rs63750083, rs63749824, rs63750577, rs267606983, rs63750218, rs63751287, rs63750900, rs145518263, rs63751475, rs63750450, rs63749805, rs63751278, rs63751106, rs63750004, rs63749806, rs63751024, rs63750248, rs63750779, rs63751139, rs63750219, rs63750298, rs63750687, rs63750851, rs1553268799, rs1561901881, rs1561905293, rs866101707, rs1566638673, rs63750009, rs1566656702, rs1566657804, rs1567885728, rs1568339995, rs1566630791, rs1555358260, rs63750964, rs1594998354, rs63751316 |
17192785 |
Apraxia |
Apraxias |
rs121908377, rs121908378, rs1135401820, rs1178491246, rs1584969672 |
|
Attention deficit hyperactivity disorder |
Attention deficit hyperactivity disorder |
rs120074176, rs786205019 |
|
Cerebellar ataxia |
Progressive cerebellar ataxia |
rs28936415, rs199476133, rs540331226, rs797046006, rs863224069, rs138358708, rs1057519429, rs750959420, rs1568440440, rs1597846084, rs759460806, rs761486324, rs1240335250, rs1596489887 |
|
Cerebral amyloid angiopathy |
CEREBRAL AMYLOID ANGIOPATHY, PRNP-RELATED |
rs104894417, rs63750579, rs63750264, rs63750066, rs63750921, rs80356710, rs80356711, rs398122414, rs1555782101 |
|
Creutzfeldt-jakob disease |
New Variant Creutzfeldt-Jakob Disease, Creutzfeldt-Jakob Disease, Familial, Creutzfeldt-Jakob Disease, Sporadic |
rs193922906, rs74315401, rs28933385, rs74315412, rs398122370 |
23349890, 10790216, 12572668, 10790216, 23349890, 12572668, 10790216 |
Dentatorubral pallidoluysian atrophy |
Dentatorubral-Pallidoluysian Atrophy |
rs60216939 |
25401298 |
Dysautonomia |
Dysautonomia |
rs111033171, rs137853022, rs28939712, rs754348901, rs749052963, rs1057517169, rs1057516865, rs763445509, rs767527819, rs781333644, rs1239081703, rs1554696574, rs539544212, rs1201626345, rs774890086, rs1554703061, rs1554703613, rs1319053366, rs1554703851, rs868073099, rs926177767, rs376078668, rs1554695299, rs1554696648, rs1554696934, rs1554699327, rs1554691572, rs1554695846, rs1554697001, rs770668926, rs1554698037, rs759412460, rs1554702142, rs765572951, rs1554702880, rs1554703831, rs760774999, rs1554696650, rs757972943, rs1554703874, rs1554703907, rs571348995 |
|
Epileptic encephalopathy |
Encephalopathies |
rs587776508, rs121918334, rs121918317, rs121918321, rs74315390, rs28939684, rs74315391, rs74315392, rs118192244, rs121918622, rs121918623, rs121917953, rs121917955, rs121918624, rs121918625, rs121918626, rs121918629, rs121918632, rs118192218, rs118192219, rs118192222, rs118192226, rs118192228, rs118192234, rs118192236, rs118192235, rs118192242, rs118192185, rs118192188, rs118192246, rs118192186, rs118192194, rs118192199, rs118192201, rs118192202, rs118192203, rs118192204, rs118192205, rs118192206, rs118192208, rs118192215, rs118192216, rs118192239, rs397514458, rs387906686, rs202151337, rs121917957, rs121917929, rs121917927, rs121917966, rs121917941, rs121917964, rs121917943, rs121917965, rs121917918, rs121917963, rs121917911, rs121917912, rs121917986, rs121917987, rs121917913, rs121917945, rs121917996, rs121917975, rs121917919, rs121917993, rs121917915, rs121917995, rs121917976, rs121917994, rs121917926, rs121917951, rs121917952, rs121917980, rs121917921, rs121917935, rs121917936, rs121917984, rs121917937, rs121917985, rs121917938, rs121917928, rs121918753, rs121918781, rs121918782, rs121918784, rs121918734, rs121918788, rs121917969, rs121918775, rs121918786, rs121918796, rs121918745, rs121918740, rs121918741, rs121918789, rs121918742, rs121918791, rs121918811, rs121917922, rs121918744, rs121918778, rs121918767, rs121918779, rs121918770, rs121918783, rs121918773, rs121918793, rs267606051, rs398123585, rs398123588, rs398123593, rs587777164, rs587777219, rs587777310, rs587780446, rs587777492, rs587777495, rs587777577, rs267608501, rs587777721, rs587783192, rs587783200, rs104894745, rs587784453, rs587784454, rs587784438, rs587784440, rs727504136, rs727503974, rs727504140, rs727504173, rs201497300, rs786204967, rs794726739, rs794726845, rs779614747, rs794726726, rs794726763, rs794726754, rs794726760, rs794726759, rs199727342, rs794726800, rs794726752, rs794726825, rs794726809, rs794726696, rs794726699, rs794726705, rs794726784, rs794726779, rs794726821, rs146878122, rs794726816, rs794726744, rs794726854, rs794726710, rs794726733, rs542420576, rs794726772, rs794726842, rs794726718, rs794726761, rs794726697, rs794726775, rs397514459, rs767045134, rs794726766, rs794726742, rs794726730, rs794726778, rs794726736, rs794726773, rs794726790, rs794726826, rs794726753, rs794726799, rs794726844, rs794726782, rs794726798, rs794726824, rs794726827, rs794726803, rs794726711, rs794726762, rs786205598, rs863223345, rs794727128, rs794727337, rs794727361, rs794727444, rs794727740, rs794727792, rs794727970, rs863225068, rs796053181, rs796053130, rs796053048, rs796053086, rs796053103, rs796053043, rs796053085, rs796053035, rs796053031, rs796053029, rs796053022, rs139300715, rs796053014, rs1553522472, rs796053010, rs121917908, rs796053008, rs794726789, rs796053004, rs796053072, rs796052995, rs796053067, rs796052990, rs796052987, rs796052985, rs796053065, rs1553543316, rs796053064, rs796052977, rs796052976, rs796052973, rs796052972, rs781746113, rs796052960, rs796052959, rs796053054, rs1553551312, rs796052953, rs758871507, rs796053350, rs1554776228, rs796053352, rs796053390, rs796053353, rs796053359, rs796053361, rs796053366, rs796053367, rs796053370, rs796053368, rs796053373, rs796053376, rs796053377, rs1554768992, rs796053335, rs796053233, rs796053214, rs796053216, rs796053224, rs796053228, rs796053229, rs796052658, rs796052670, rs796052654, rs796052653, rs796052652, rs773171451, rs1555853593, rs759584387, rs796052650, rs118192233, rs796052657, rs796052644, rs796052645, rs796052641, rs796052640, rs775918190, rs796052636, rs796052626, rs796052623, rs796052621, rs796052620, rs796052618, rs796052617, rs796052663, rs797044983, rs797045013, rs797044878, rs797044951, rs797044873, rs797044938, rs797045969, rs118192212, rs863225037, rs863225036, rs863225030, rs863225031, rs864321707, rs864321712, rs869312684, rs869312920, rs869312939, rs878853250, rs878854263, rs878854262, rs751170778, rs878854974, rs878855236, rs1555794286, rs879255652, rs879255695, rs879255697, rs879255704, rs879255705, rs879255709, rs879255710, rs886039323, rs886039435, rs886039494, rs886039903, rs1135401734, rs1135401733, rs1135401732, rs886042004, rs886041716, rs886041961, rs886041668, rs886041246, rs886041339, rs886041766, rs886041262, rs886041715, rs886042528, rs886042605, rs886063501, rs1555850151, rs1057516123, rs1555853971, rs1057516115, rs1057516106, rs1057516105, rs1057516099, rs1057516098, rs1057516094, rs1057516089, rs1057516086, rs1057516085, rs1057516080, rs1057516079, rs1057516076, rs1057518325, rs1057517862, rs1057517849, rs1057518243, rs1057518258, rs1057517958, rs121917974, rs1057517959, rs796053374, rs1057517919, rs1057518489, rs1057518801, rs1057518816, rs759766243, rs1057518795, rs1057518985, rs1057519000, rs1057519269, rs1057519270, rs1057519452, rs375659415, rs1057519501, rs1057519528, rs1057519526, rs1057519527, rs1057519524, rs796053083, rs1057519529, rs1057519531, rs1057519547, rs1057519548, rs1057519545, rs1057519538, rs1057519539, rs1057519537, rs1057519540, rs1057519549, rs1057519550, rs1057519535, rs1057519536, rs1057519542, rs778291283, rs1057520486, rs794726765, rs750209664, rs121917753, rs1057521746, rs1057523858, rs1057520753, rs1057520413, rs1057521080, rs1057524599, rs778481061, rs768633670, rs796052655, rs1060502190, rs1060502183, rs121918780, rs1060502185, rs1057521537, rs1060502187, rs121918765, rs1060502182, rs121917981, rs1060502188, rs1060502189, rs1060503108, rs1060501724, rs1060501722, rs1060501723, rs1060501012, rs1060504137, rs1060500603, rs1060500602, rs1060499592, rs796053138, rs1064795579, rs1553520298, rs121918805, rs1064795733, rs1064796177, rs1064795735, rs1064794634, rs1064796384, rs1064796213, rs1064793923, rs1064794727, rs1064794533, rs1064795384, rs1555850842, rs1064794001, rs1064796151, rs1064795435, rs1064797284, rs1085307930, rs1085307730, rs1085307916, rs1085307876, rs1085307920, rs1131691773, rs1131691774, rs1131691675, rs1131691775, rs1131691693, rs1131691465, rs1131691830, rs1131691936, rs1057523728, rs1199412903, rs1555228303, rs1555507477, rs1554965669, rs1555499800, rs1553923787, rs922847767, rs368609628, rs1553286282, rs1266877537, rs794726749, rs1553551425, rs1553552390, rs1554778657, rs1555889130, rs1555881741, rs1553520320, rs1553522517, rs796053006, rs1553534296, rs1553541028, rs1553544579, rs1553551385, rs1553520380, rs1553525210, rs1553541473, rs761333438, rs1553520982, rs1553522321, rs1553520318, rs1553540503, rs1553540389, rs1553542199, rs1553543215, rs1553541172, rs1553549483, rs750901301, rs794726743, rs1553545660, rs1553561023, rs1553548096, rs1553552319, rs1553560760, rs1554037381, rs1554776948, rs1554778417, rs1057522982, rs1555219147, rs1555218657, rs1555850590, rs1555869758, rs1555873823, rs1553525325, rs794727813, rs1555228771, rs1553520530, rs1555870346, rs1555955296, rs1553551493, rs1555546796, rs1555870554, rs1555871832, rs77216276, rs1554689320, rs1554777496, rs1555881809, rs1553529461, rs12131800, rs1553517274, rs1555889127, rs1555951141, rs1553590192, rs1553531178, rs1555870470, rs927722314, rs1553523142, rs1041924436, rs1553544559, rs1553544821, rs1553520319, rs1553560677, rs1553521567, rs1553522331, rs1553519872, rs1553529426, rs1553519902, rs1553520029, rs1553545522, rs1553520439, rs146515561, rs1553549461, rs1553549834, rs1553546789, rs1553553614, rs1553560676, rs1553520227, rs1553524865, rs1553525036, rs1553560740, rs1553561016, rs1193718145, rs1554769099, rs936639741, rs1352024223, rs758779535, rs1555870506, rs747376305, rs1555869700, rs1555873656, rs1555873981, rs536000212, rs959316981, rs1554777470, rs1555889108, rs1559144583, rs1569219844, rs1564346538, rs1562159088, rs1559101839, rs1559114303, rs1559140110, rs1559140306, rs1043031572, rs121918756, rs1559199628, rs1559200672, rs796053095, rs1559210063, rs1559225495, rs1553549471, rs1559103294, rs1559105368, rs121918764, rs1559114837, rs1559122124, rs1559127505, rs1559128532, rs1559140855, rs1559149128, rs1559217391, rs1559220874, rs794726695, rs1559249734, rs1553553527, rs1559101585, rs1559110846, rs1559193050, rs1559216338, rs1559231284, rs148442069, rs1559105301, rs1559114202, rs121917954, rs1559195296, rs1553546763, rs1559238432, rs1559884460, rs1559887808, rs1564352002, rs1564349850, rs1564351103, rs1565933795, rs1565886685, rs1555228668, rs587777723, rs1564333757, rs375363057, rs1568932480, rs1568925719, rs770187706, rs1568864658, rs1568899375, rs118192209, rs1568932462, rs1568927747, rs1057518555, rs1559119345, rs1085307520, rs1559200901, rs970867558, rs1568940442, rs775162839, rs1568986619, rs1558308998, rs1553546668, rs1569017015, rs1569017045, rs1569017073, rs1555889090, rs1569017143, rs1569017148, rs1569017205, rs1179351306, rs1569017257, rs1569017337, rs1555889162, rs1568658507, rs1485894376, rs1561139569, rs1574716488, rs1553519865, rs1573946994, rs1573948129, rs121918812, rs1573950349, rs1573952908, rs1573964264, rs1573964628, rs372425457, rs1573984004, rs1574004452, rs1574005235, rs1574006637, rs1574006857, rs1574039742, rs121918801, rs1574051496, rs1574051665, rs1574060250, rs1574060717, rs1574169179, rs1574170908, rs121918774, rs1574192005, rs1574192998, rs1574201591, rs1574216450, rs1574223964, rs1574224274, rs1574225593, rs748267258, rs1553547380, rs1574263819, rs1574265144, rs762927460, rs1574266490, rs1574271827, rs1574302195, rs1574371399, rs1575603683, rs763339068, rs1588313568, rs1589416130, rs1592380672, rs1592148206, rs1592149793, rs1592149906, rs1592162415, rs1592162506, rs1596787821, rs1600755607, rs1600755429, rs1600731888, rs1601573302, rs1601566621, rs1601542702, rs1601542417, rs1600886270, rs1600766500, rs1574370981, rs1573962555, rs1574068971, rs1057524737, rs1574263047, rs1575601202, rs1554777464, rs1589393179, rs1597696047, rs1247507359, rs752927520, rs1473654961, rs1592380834, rs796053036, rs1573953706, rs1573973548, rs1573984110, rs1574007140, rs1574166948, rs745378416, rs1574209023, rs796053094, rs1574264920, rs1600714727, rs755159935, rs1574281711, rs779324355, rs1053767552, rs201894374, rs770456604, rs113094436, rs1578264574, rs1260191836, rs1578265048, rs1578265068, rs1578269200, rs1186496501, rs1578269761, rs756467468, rs1381665298, rs1578270476, rs1578274054, rs769243823, rs200059198, rs749975104, rs1578282133, rs1306655122, rs1600785769, rs1580990072, rs1584399108, rs1057519189, rs1595440453, rs1596872804, rs1597653264, rs1597676610, rs1599719527, rs1600755440, rs1600786071, rs770904422, rs1574525321, rs1840653547, rs749965674, rs1841611651, rs1841766225, rs1852152679, rs1853919580, rs1858669268, rs1941650264, rs1941714576, rs1938725748, rs2037920694, rs2037920791, rs2079949302, rs2079962041, rs2079972258, rs2080188103, rs2080189052, rs1057520773, rs2081071680, rs2081187047, rs2081187692, rs2081358991, rs2081378550, rs1698943949, rs1698602170, rs1698192456, rs1698176171, rs1369404945, rs1698003832, rs1698002491, rs1697999557, rs398123581, rs1697674296, rs1697473667, rs1697277384, rs1697160366, rs1697157422, rs1426666349, rs1697134047, rs1696883051, rs1696628056, rs794726823, rs1696403750, rs897883046, rs1696401617, rs1696356978, rs1696338792, rs1693176153, rs1692577292, rs1240187329, rs1553529527, rs1692166604, rs1691093633, rs1691039670, rs1690583220, rs1690345764, rs1690011364, rs1553521530, rs1553521051, rs1386425283, rs1573952473, rs1689300152, rs1689298888, rs1689285717, rs1689278461, rs1238612161, rs1689271621, rs1253117981, rs1689218857, rs1689211960, rs1689211569, rs1689200375, rs1689142827, rs1684673339, rs1684663586, rs1699367901, rs1553553462, rs1699149959, rs1698958802, rs746440689, rs1692586274, rs1697876590, rs727504142, rs1689985819, rs794726764, rs1704944478, rs1178244073, rs1840967817, rs2080693649, rs1938214529, rs2080696874, rs2081190512, rs1691073965, rs1689488709, rs1691048388, rs1692581621, rs1692870117, rs121918785, rs749539763, rs1842042825, rs2081190344, rs1600789325 |
|
Gastric cancer |
Hereditary Diffuse Gastric Cancer |
rs137854571, rs63751108, rs34612342, rs121908383, rs121909144, rs121909775, rs121909219, rs121909223, rs63750871, rs80359530, rs121964873, rs121913530, rs606231203, rs121918505, rs587776802, rs28933369, rs121912469, rs80358011, rs397507262, rs80359439, rs397507333, rs80359543, rs80358831, rs80359596, rs80358920, rs80358972, rs80359659, rs397507404, rs397514661, rs80359516, rs200495564, rs80358419, rs80359274, rs80359283, rs80358427, rs80358428, rs80358435, rs81002805, rs397507660, rs397507663, rs80359391, rs80359443, rs81002797, rs80359466, rs397507752, rs80359484, rs80359603, rs397507954, rs80359058, rs80359071, rs397507981, rs80359121, rs80357086, rs80357064, rs397508936, rs80357695, rs80357661, rs397509035, rs80357544, rs80357577, rs80357881, rs80357296, rs80356923, rs80356866, rs80357504, rs80357390, rs80357239, rs80358099, rs397509284, rs80357258, rs199474738, rs199474747, rs587779204, rs63750439, rs267608076, rs587779246, rs63749999, rs267608078, rs63751327, rs267607719, rs267607734, rs63750706, rs63751711, rs587779047, rs587779075, rs267607949, rs63750633, rs63750803, rs63751618, rs267608154, rs200640585, rs80358018, rs80357857, rs80357882, rs180177103, rs587779815, rs587779865, rs587779872, rs587780059, rs121912666, rs587780088, rs587780104, rs200432447, rs180177100, rs587780226, rs587780784, rs587776416, rs587781276, rs587781629, rs587781694, rs587781727, rs587781730, rs587781807, rs587781894, rs587781948, rs121913344, rs587782292, rs587782350, rs587782558, rs587782719, rs587782885, rs587783057, rs730881833, rs730881411, rs730881336, rs139770721, rs730881869, rs730881633, rs730882007, rs786203115, rs765123255, rs1553333738, rs762083530, rs786202800, rs17174393, rs55996097, rs750621215, rs786203451, rs747604569, rs764389018, rs786204433, rs786204862, rs772821016, rs779582317, rs863225406, rs193922343, rs759965045, rs63749919, rs760228510, rs746481984, rs762307622, rs876659736, rs876660933, rs747727055, rs1450394308, rs876658348, rs876658431, rs876659326, rs876660444, rs730881369, rs878853865, rs753862052, rs587780024, rs138941496, rs886040739, rs886040744, rs886040347, rs878854957, rs886040123, rs398122662, rs886040942, rs1057517104, rs1057516320, rs1057516683, rs879254046, rs1057517253, rs587781927, rs985033810, rs1057519989, rs775464903, rs374230313, rs758304323, rs1060501599, rs758081262, rs1060500126, rs1060502734, rs587776408, rs1060501695, rs1114167816, rs1114167596, rs1114167667, rs1555460315, rs1135402788, rs1554086196, rs730881919, rs773356478, rs769237459, rs1553653158, rs587782087, rs1555107263, rs1555119940, rs1403784434, rs1342519012, rs751710099, rs1553616361, rs1553619721, rs1270783041, rs775036118, rs1555288557, rs1555460548, rs1555461154, rs1298667185, rs1553622218, rs63751101, rs1349928568, rs771936821, rs1021662947, rs1555921011, rs81002831, rs1555124506, rs1555574803, rs1060502716, rs1555605362, rs747057367, rs1565385010, rs1567554500, rs1567516230, rs1558644995, rs1555591308, rs778306619, rs1566231194, rs1603328466, rs1570406302, rs1586108714, rs768362387, rs1597713777, rs1060502926, rs1597867185, rs1591517571, rs1591663236, rs1593903006, rs1555284779, rs1597096243, rs45459799, rs1597360340, rs587781905, rs864622481, rs1601753141, rs1966858562, rs1966967065, rs1967016153, rs1967113484, rs2080473458, rs1591387978, rs1224428422, rs1597747184, rs2082309297, rs2051929740, rs147542208 |
17387271 |
Gerstmann-straussler-scheinker syndrome |
Gerstmann-Straussler-Scheinker Disease, Gerstmann-Straussler-Scheinker syndrome |
rs193922906, rs74315401, rs74315402, rs74315405, rs74315406, rs11538758, rs74315410, rs74315413, rs74315415, rs17852079 |
24224623, 7699395, 7783876, 2564168, 8797472, 1363810, 10581485, 16831973, 19927125, 7902972, 11709001, 9786248, 10203975, 1439789 |
Huntington disease-like |
HUNTINGTON DISEASE-LIKE 1 |
rs193922906, rs74315401, rs28933385, rs74315403, rs74315405, rs74315406, rs74315411, rs74315410, rs74315412, rs80356711 |
11756597, 8939199, 17494694, 1363809, 16831973, 20514992, 16939293, 22584955, 25064618, 24275071, 20541558, 10079068, 22072968, 14967768, 23723004, 2572450, 22318125, 11593450, 1363810, 26791950, 25959220, 20593190, 21298055, 25522698, 27803826, 12372829, 23296137, 20139714, 9813003, 10360778, 23132868, 15366237, 11839833 |
Myoclonic epilepsy |
Familial Progressive Myoclonic Epilepsy, Myoclonic Epilepsies, Progressive |
rs267607103, rs267607104, rs137852778, rs137852781, rs147484110, rs74315442, rs74315443, rs121909346, rs121918622, rs121918623, rs121917954, rs121917955, rs1574272192, rs121918624, rs121918625, rs121918628, rs121918629, rs121918630, rs1574061044, rs121918632, rs397514458, rs397514459, rs386833439, rs386833440, rs386833441, rs796943858, rs386833443, rs398122387, rs121917923, rs121917957, rs121917929, rs121917927, rs121917966, rs121917967, rs121917990, rs121917941, rs121917964, rs121917943, rs121917972, rs121917965, rs121917918, rs121917963, rs121917911, rs121917912, rs121917986, rs121917987, rs121917913, rs121917974, rs121917945, rs121917975, rs121917919, rs121917993, rs121917915, rs121917995, rs121917976, rs121917949, rs121917926, rs121917950, rs121917951, rs121917952, rs121917980, rs121917921, rs121917981, rs121917935, rs121917936, rs121917984, rs121917937, rs121917985, rs121917909, rs121917938, rs121917928, rs121918753, rs121918782, rs121918784, rs121918733, rs121918734, rs121918788, rs121918736, rs121917969, rs121918775, rs121918737, rs121918786, rs121918796, rs121918754, rs121918745, rs121918738, rs121918746, rs121918740, rs121918741, rs121918789, rs121918742, rs121918791, rs121918811, rs121917922, rs121918797, rs121918744, rs121918778, rs121918767, rs121918779, rs121918770, rs121918763, rs121918757, rs121918751, rs121918783, rs121918773, rs121918793, rs121918780, rs121918735, rs398123585, rs398123588, rs398123593, rs545986367, rs727504136, rs794726737, rs794726739, rs794726845, rs779614747, rs794726726, rs372098964, rs794726801, rs794726769, rs794726781, rs794726780, rs794726741, rs794726783, rs794726832, rs794726814, rs794726722, rs794726703, rs794726702, rs794726763, rs794726802, rs794726804, rs794726748, rs794726851, rs794726740, rs794726754, rs794726698, rs794726758, rs794726760, rs794726819, rs794726839, rs794726759, rs199727342, rs794726701, rs794726850, rs794726785, rs794726800, rs764037830, rs794726757, rs794726752, rs794726825, rs794726835, rs139300715, rs794726809, rs794726696, rs794726734, rs794726699, rs794726705, rs794726784, rs794726745, rs794726707, rs794726779, rs794726821, rs794726822, rs794726789, rs794726723, rs146878122, rs794726816, rs794726700, rs794726853, rs794726731, rs794726852, rs794726841, rs794726709, rs777939538, rs794726817, rs794726727, rs794726706, rs794726770, rs794726735, rs794726744, rs794726854, rs794726710, rs794726720, rs794726836, rs794726774, rs794726729, rs794726728, rs794726733, rs542420576, rs794726756, rs794726813, rs794726830, rs794726714, rs794726772, rs1696406839, rs794726842, rs794726828, rs794726823, rs794726708, rs794726808, rs794726716, rs121917971, rs794726718, rs794726721, rs794726761, rs794726815, rs794726786, rs794726787, rs794726697, rs794726775, rs794726712, rs794726794, rs794726738, rs794726805, rs767045134, rs794726820, rs794726766, rs794726750, rs794726743, rs794726742, rs794726795, rs794726730, rs794726806, rs794726747, rs794726838, rs794726778, rs794726834, rs794726736, rs794726704, rs794726773, rs794726749, rs794726717, rs794726790, rs794726829, rs794726807, rs794726810, rs121917989, rs794726826, rs794726725, rs794726818, rs794726776, rs794726777, rs794726765, rs794726753, rs794726732, rs794726799, rs794726695, rs794726792, rs794726767, rs794726768, rs794726844, rs794726782, rs794726797, rs794726843, rs794726798, rs794726824, rs794726837, rs794726846, rs794726788, rs794726847, rs794726812, rs794726771, rs794726751, rs773407463, rs794726755, rs794726719, rs794726724, rs794726833, rs794726827, rs1553551314, rs794726840, rs794726849, rs794726764, rs794726803, rs794726831, rs794726711, rs794726793, rs760361423, rs794726796, rs794726762, rs35595680, rs764444350, rs794726848, rs786205214, rs794729200, rs794729207, rs796053029, rs796053014, rs796053010, rs796053004, rs796053001, rs796052973, rs779184118, rs781746113, rs796052961, rs796052957, rs863225037, rs863225036, rs863225035, rs863225034, rs863225033, rs863225032, rs863225030, rs863225038, rs863225031, rs869312670, rs869312684, rs886039430, rs121917959, rs886041980, rs886042528, rs781507889, rs1057517959, rs1057518671, rs1057519533, rs1057519534, rs1057519530, rs1057519531, rs1060502189, rs1064794766, rs748759187, rs368609628, rs1553345874, rs121918795, rs1266877537, rs1553266166, rs1553522321, rs1553543215, rs1553525325, rs1553520530, rs1553544470, rs1553551493, rs1553553462, rs1553560831, rs201966711, rs537026414, rs1559101839, rs1559114303, rs1559149128, rs1553553527, rs1569006250, rs781657502, rs1574370981, rs1366966423, rs1574312497, rs796053036, rs1573949198, rs1573953706, rs1573963975, rs1573973548, rs1573984110, rs1574005699, rs1574007140, rs1574052179, rs1574069132, rs1574166948, rs1574168611, rs1574183148, rs886041292, rs1574208760, rs1574209023, rs1574217232, rs1553545567, rs796053094, rs1574240716, rs1553549471, rs1574264920, rs1574266816, rs1574271602, rs1574271644, rs1574291210, rs1574371141, rs1574371902, rs796052488, rs1581220163, rs1196223064, rs1574182550, rs1573953030, rs1574201555, rs1581829739, rs1574281711, rs1696401617, rs1692166604, rs1574006637, rs1689139851, rs1689186812, rs1689309551, rs1689680658, rs1697997770, rs1698732089, rs1698941202, rs1697667767, rs1691073965, rs1698009615 |
25401298 |
Nystagmus |
Nystagmus |
rs137852207, rs137852208, rs1928435502, rs137852209, rs137852210, rs1929191668, rs137852211, rs137852212, rs2124209414, rs387906720, rs387906721, rs1602791884, rs786205896 |
|
Parkinson disease |
Parkinsonian Disorders |
rs116074753, rs118203903, rs118203904, rs115735611, rs33939927, rs35801418, rs34805604, rs35870237, rs34995376, rs74315355, rs28940284, rs74315356, rs74315357, rs28940285, rs730880302, rs750664040, rs74315359, rs74315360, rs45539432, rs74315361, rs119451946, rs80356771, rs74500255, rs75822236, rs1141814, rs78973108, rs121908681, rs121908686, rs121908687, rs137853054, rs137853055, rs137853056, rs137853057, rs137853058, rs137853059, rs34424986, rs137853060, rs397518439, rs28938172, rs74315351, rs74315353, rs137853051, rs118192098, rs121917767, rs121918104, rs1589451049, rs104893877, rs104893878, rs283413, rs112176450, rs111290936, rs188286943, rs387906863, rs387906864, rs774631197, rs199935023, rs387906942, rs397514694, rs398122403, rs398122404, rs398122405, rs104886460, rs409652, rs431905511, rs63751392, rs756677845, rs864309527, rs864309650, rs750014782, rs1554391082, rs864622011, rs869312810, rs869312809, rs869312811, rs369100678, rs879253853, rs869320761, rs747506979, rs879255630, rs886039854, rs191486604, rs781442277, rs1060499619, rs751037529, rs55777503, rs768091663, rs34208370, rs1553122929, rs772786691, rs754809877, rs1555907463, rs1557561340, rs781600849, rs141263564, rs1557901552, rs777160388, rs756783990, rs867929413, rs1237637353, rs1005937012, rs755000580, rs747427602, rs1578089802, rs771586218, rs748142049, rs1582953433, rs746646126, rs771529549, rs121918106 |
|
Prostate cancer |
Malignant neoplasm of prostate |
rs121909139, rs121909140, rs121909141, rs121909142, rs121909143, rs606231169, rs606231170, rs137852584, rs137852578, rs137852580, rs137852581, rs137852582 |
17199135 |
Spongiform encephalopathy with neuropsychiatric features |
SPONGIFORM ENCEPHALOPATHY WITH NEUROPSYCHIATRIC FEATURES |
rs74315401, rs74315411, rs74315413, rs74315414 |
12214108, 9266722 |
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Akinetic mutism |
Akinetic Mutism |
|
|
Alzheimer-like prion disease |
Familial Alzheimer-like prion disease |
|
21416485 |
Amyloidosis of peripheral nerves |
Amyloidosis of peripheral nerves |
|
|
Anxiety disorder |
Anxiety |
|
|
Aphasia |
Aphasia |
|
|
Cerebellar atrophy |
Cerebellar atrophy |
|
|
Cerebral cortical atrophy |
Cerebral cortical atrophy |
|
|
Delusions |
Delusions |
|
|
Dementia |
Dementia |
|
16831973, 20583301 |
Dysarthria |
Dysarthria |
|
|
Dysphagia |
Deglutition Disorders |
|
|
Dyssomnia |
Dyssomnias |
|
|
Fatal insomnia |
Fatal Familial Insomnia |
|
1347910, 1439789, 16227536, 16831973, 19927125 |
Hallucinations |
Hallucinations |
|
|
Hemiplegia |
Hemiplegia, Spastic |
|
|
Hepatolenticular degeneration |
Hepatolenticular Degeneration, Hepatic Form of Wilson Disease |
|
16831968 |
Hypersomnia |
Hypersomnia |
|
|
Inclusion-body disease |
Atypical Inclusion-Body Disease |
|
25401298 |
Kuru |
Kuru |
|
11120925 |
May-white syndrome |
May-White Syndrome |
|
25401298 |
Mental depression |
Depressive disorder, clinical depression |
rs587778876, rs587778877 |
21439331, 26152722 |
Mood disorder |
Mood Disorders |
|
21439331 |
Mood swings |
Mood swings |
|
|
Movement disorders |
Movement Disorders |
|
16769939, 16831973, 15824374, 8250529, 16391566, 10963679, 9669700, 10408557, 20216075, 10541874, 15883322, 11709001, 7699395, 7902972, 12420099, 28987186, 23518043, 21911696, 12451207, 28778873 |
Nystagmus associated with disorder of the vestibular system |
Nystagmus associated with disorder of the vestibular system |
|
|
Prostatic neoplasms |
Prostatic Neoplasms |
|
17199135 |
Prp systemic amyloidosis |
PrP systemic amyloidosis |
|
|
Psychosis |
Psychotic Disorders |
|
|
Senile dementia |
Presenile dementia, Acute Confusional Senile Dementia |
|
17192785 |
Senile plaques |
Senile Plaques |
|
|
Sleep disorders |
Sleep Disorders |
|
|
Specific learning disorder |
Specific learning disability |
rs1057519497 |
|
Sporadic fatal insomnia |
Sporadic fatal insomnia |
|
|
Stomach neoplasms |
Malignant neoplasm of stomach, Stomach Neoplasms |
|
17387271 |
Trigeminal neuralgia |
Trigeminal Neuralgia |
|
|
|
|
|