SEPSECS (Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
51091 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
SEPSECS |
SynonymsGene synonyms aliases
|
LP, PCH2D, SLA, SLA-p35, SLA/LP, SecS |
ChromosomeChromosome number
|
4 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
4p15.2 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
The amino acid selenocysteine is the only amino acid that does not have its own tRNA synthetase. Instead, this amino acid is synthesized on its cognate tRNA in a three step process. The protein encoded by this gene catalyzes the third step in the process, |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs146539065 |
C>T |
Likely-pathogenic |
Synonymous variant, coding sequence variant |
rs267607035 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs267607036 |
T>C |
Pathogenic |
Coding sequence variant, missense variant |
rs757504141 |
T>C |
Likely-pathogenic |
Intron variant |
rs773876739 |
T>A,C |
Pathogenic |
Coding sequence variant, missense variant |
rs776969714 |
->C |
Pathogenic, pathogenic-likely-pathogenic |
Coding sequence variant, splice acceptor variant |
rs779387647 |
C>A |
Likely-pathogenic |
Stop gained, coding sequence variant |
rs1057518887 |
C>T |
Likely-pathogenic |
Intron variant |
rs1309003036 |
G>A,C |
Pathogenic |
Missense variant, stop gained, coding sequence variant, 5 prime UTR variant |
rs1553878395 |
AAAGATATGGGATTGTGAGGTGTATGCAACAGTCTTTCATTGTAGGCTTCTGACAACTTCTTTATTTGGTTGGACAAATATGAAAACATTTCCT>- |
Likely-pathogenic |
Splice acceptor variant, splice donor variant, coding sequence variant |
rs1553881510 |
->T |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1553881788 |
T>C |
Likely-pathogenic |
5 prime UTR variant, coding sequence variant, missense variant |
rs1577599764 |
C>A |
Likely-pathogenic |
Splice acceptor variant |
rs1577629146 |
GA>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
Q9HD40 |
Protein name |
O-phosphoseryl-tRNA(Sec) selenium transferase (EC 2.9.1.2) (Liver-pancreas antigen) (LP) (SLA-p35) (SLA/LP autoantigen) (Selenocysteine synthase) (Sec synthase) (Selenocysteinyl-tRNA(Sec) synthase) (Sep-tRNA:Sec-tRNA synthase) (SepSecS) (Soluble liver ant |
Protein function |
Converts O-phosphoseryl-tRNA(Sec) to selenocysteinyl-tRNA(Sec) required for selenoprotein biosynthesis. |
PDB |
3HL2
,
4ZDL
,
4ZDO
,
4ZDP
,
7L1T
,
7MDL
,
8G9Z
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF05889 |
SepSecS |
61 → 459 |
O-phosphoseryl-tRNA(Sec) selenium transferase, SepSecS |
Domain |
|
Sequence |
|
Sequence length |
501 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Arthrogryposis multiplex congenita |
Arthrogryposis |
rs1586285494, rs80358233, rs137853305, rs1559154278, rs398124167, rs398124172, rs587780399, rs786204576, rs786204430, rs769345284, rs749355583, rs793888524, rs793888525, rs878854368, rs555445835, rs758105619, rs886041851, rs794727136, rs755239192, rs760715690, rs773952935, rs112610938, rs1057516676, rs1057516996, rs780022652, rs1057517399, rs1057517360, rs1057518353, rs1057517977, rs1064796311, rs779232987, rs775997446, rs1064797093, rs1064797094, rs1064797095, rs755500591, rs754272530, rs758247804, rs200731870, rs747179265, rs1553740233, rs776569219, rs375628303, rs775631800, rs781667543, rs1553548666, rs928945364, rs763364977, rs1458048713, rs1553883480, rs1472403020, rs1336053002, rs202048855, rs1197561990, rs755531536, rs1554112524, rs762133567, rs1553555882, rs934111355, rs1255744452, rs1366269616, rs1555734932, rs1553548207, rs752582527, rs1257495033, rs113525641, rs755863625, rs374929094, rs539819851, rs1366853918, rs1218073575, rs1553537512, rs1553552384, rs747564597, rs776059611, rs756726488, rs1357811155, rs1553939600, rs772009599, rs1255445731, rs1011425121, rs1553561697, rs1553551748, rs1553552413, rs760935667, rs1553603400, rs1302373559, rs1389892619, rs1553710982, rs757157808, rs1180339426, rs761964375, rs1235589246, rs1443738549, rs1553934586, rs1553934597, rs1553603437, rs749452641, rs1553904694, rs754369875, rs112517981, rs774495973, rs1428597732, rs746999970, rs113091511, rs1553603958, rs1553469502, rs770797137, rs1553608621, rs1159756073, rs776167256, rs778593702, rs1553601066, rs1553689774, rs760768475, rs1559296376, rs201636991, rs1559039815, rs748922882, rs772366030, rs1207534366, rs1259297878, rs762780413, rs1559360386, rs1559940778, rs760200697, rs1344099907, rs750900690, rs1559168230, rs746177326, rs761067911, rs1323364980, rs537560378, rs1319778592, rs1340063197, rs1577833924, rs750585238, rs1600470099, rs1575714905, rs1576203853, rs779909544, rs760124743, rs2096362304, rs1212374733, rs1490309743, rs767709270, rs1374971806, rs2096491549, rs2097886912, rs2099021112, rs2097758221, rs1474341248, rs925947627 |
|
Developmental delay |
Global developmental delay |
rs28941770, rs199469464, rs281865469, rs143747297, rs398123009, rs587777428, rs786205133, rs606231459, rs797044854, rs797045027, rs864309504, rs878853160, rs886039902, rs886042046, rs886041291, rs886041382, rs1057518991, rs1057518699, rs753254213, rs748294403, rs762552974, rs1135401795, rs1553121073, rs1553122926, rs1364690005, rs1554086554, rs1554210415, rs1554168326, rs1554776342, rs1553873247, rs1567860112, rs779009256, rs1557447255, rs1564568350, rs780011005, rs1597464953, rs1200336864, rs1569513017, rs1587459606, rs1570332505, rs748888652, rs1575155995, rs2087029320, rs1589669105, rs1601769604, rs1184981709, rs749201074 |
|
Spastic diplegia |
Little`s Disease |
rs672601336 |
|
Nystagmus |
Nystagmus |
rs137852207, rs137852208, rs1928435502, rs137852209, rs137852210, rs1929191668, rs137852211, rs137852212, rs2124209414, rs387906720, rs387906721, rs1602791884, rs786205896 |
|
Pontoneocerebellar hypoplasia |
Pontocerebellar Hypoplasia Type 2, PONTOCEREBELLAR HYPOPLASIA, TYPE 2D, Congenital pontocerebellar hypoplasia |
rs63749985, rs113994152, rs113994153, rs113994154, rs113994150, rs137853063, rs267607036, rs267607035, rs886037629, rs147391618, rs141138948, rs672601331, rs387907196, rs672601332, rs397515426, rs398122918, rs587780333, rs374550999, rs587777391, rs587777392, rs587777393, rs587777394, rs587777395, rs587777465, rs587777466, rs587777616, rs606231285, rs587784476, rs886037738, rs886037739, rs730880294, rs886037740, rs730882145, rs746260871, rs796052019, rs371295780, rs772731615, rs797046052, rs797046051, rs756696262, rs797045567, rs797046057, rs797046054, rs797046055, rs863224183, rs199835443, rs863224182, rs863224186, rs757743894, rs772887102, rs774923951, rs875989844, rs879253779, rs879253780, rs776969714, rs886041639, rs886041316, rs1057518749, rs1057518750, rs1057518887, rs1057519294, rs1057519296, rs1553730885, rs1570621473, rs371848318, rs777030573, rs758153898, rs1064795060, rs777942571, rs1554203400, rs779282547, rs1553230375, rs765088174, rs759922477, rs1554093168, rs755246924, rs1477347690, rs774157225, rs1420939606, rs781417096, rs780563835, rs772263867, rs139632595, rs768997239, rs200594402, rs1160669103, rs759331139, rs1566713184, rs753591864, rs769473411, rs1566696845, rs201467485, rs1258569046, rs1598480419, rs1309003036, rs759420180, rs199728745, rs773838753, rs1582712331, rs772146380, rs1223645705, rs774056037, rs1570621555, rs778263701, rs1557531984, rs750266350, rs1570626350, rs1584071201, rs1582576986, rs1246937494, rs1650621772, rs760433806, rs1447478732, rs1472685858, rs1712612585, rs1256144022, rs774755297, rs752086581, rs1887100431, rs762979613, rs774877872, rs201386427, rs199862050 |
20920667, 12920088, 20920667, 26888482, 26115735, 28133863, 20920667, 12920088 |
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Cerebellar atrophy |
Cerebellar atrophy |
|
|
Cerebellar hypoplasia |
Cerebellar Hypoplasia |
|
|
Cerebral atrophy |
Cerebral atrophy |
|
|
Dysarthria |
Dysarthria |
|
|
Dyskinetic syndrome |
Dyskinetic syndrome |
|
|
Dyssomnia |
Dyssomnias |
|
|
Exotropia |
Exotropia |
|
|
Hypoglycemia |
Hypoglycemia |
|
|
Hypoplasia of corpus callosum |
Hypoplasia of corpus callosum |
|
|
Progressive cerebello-cerebral atrophy |
Progressive cerebello-cerebral atrophy |
|
|
Ptosis |
Blepharoptosis |
rs139920573 |
|
Sleep disorders |
Sleep Disorders |
|
|
Spastic quadriplegia |
Spastic Quadriplegia |
|
|
|
|
|