Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
5076 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Paired box 2 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
PAX2 |
SynonymsGene synonyms aliases
|
FSGS7, PAPRS, PAX-2 |
ChromosomeChromosome number
|
10 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
10q24.31 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcrip |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs41291450 |
C>T |
Conflicting-interpretations-of-pathogenicity |
Coding sequence variant, genic downstream transcript variant, synonymous variant |
rs75399846 |
C>T |
Pathogenic, not-provided |
Stop gained, genic downstream transcript variant, coding sequence variant |
rs75462234 |
G>-,GG,GGG |
Pathogenic |
Frameshift variant, genic downstream transcript variant, coding sequence variant |
rs76675173 |
TGGCCCACCAGGGTGTGCGGCC>- |
Pathogenic |
Frameshift variant, genic downstream transcript variant, coding sequence variant |
rs77777862 |
C>- |
Pathogenic |
Frameshift variant, genic downstream transcript variant, coding sequence variant |
rs78122364 |
C>A,T |
Pathogenic |
Stop gained, genic downstream transcript variant, coding sequence variant, synonymous variant |
rs78738655 |
C>T |
Likely-pathogenic, likely-benign |
Genic downstream transcript variant, missense variant, coding sequence variant |
rs79555199 |
G>A,C |
Pathogenic, likely-pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant |
rs104894170 |
G>C |
Pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant |
rs139724326 |
C>G,T |
Likely-pathogenic |
Genic downstream transcript variant, stop gained, synonymous variant, coding sequence variant |
rs387906530 |
->AGACCG |
Likely-pathogenic |
Coding sequence variant, genic downstream transcript variant, inframe insertion |
rs543423053 |
G>T |
Conflicting-interpretations-of-pathogenicity |
Genic downstream transcript variant, coding sequence variant, synonymous variant |
rs587777708 |
G>A |
Pathogenic |
Coding sequence variant, missense variant, genic downstream transcript variant |
rs747453876 |
T>C |
Pathogenic |
Genic downstream transcript variant, intron variant, splice donor variant |
rs754146050 |
G>A,T |
Likely-pathogenic |
Coding sequence variant, stop gained, missense variant, genic downstream transcript variant |
rs878853000 |
G>A,T |
Likely-pathogenic |
Intron variant |
rs886037754 |
GC>- |
Pathogenic |
Coding sequence variant, frameshift variant, genic downstream transcript variant |
rs886037755 |
G>A |
Pathogenic |
Coding sequence variant, missense variant, genic downstream transcript variant |
rs886037756 |
->GTGAACC |
Pathogenic |
Coding sequence variant, frameshift variant, genic downstream transcript variant |
rs886037757 |
->AC |
Pathogenic |
Coding sequence variant, frameshift variant, genic downstream transcript variant |
rs1057518761 |
TACTACGAGACCGG>- |
Likely-pathogenic |
Splice acceptor variant, genic downstream transcript variant, coding sequence variant |
rs1131692055 |
G>A |
Pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant |
rs1554856032 |
C>T |
Pathogenic |
Missense variant, coding sequence variant, genic downstream transcript variant |
rs1554856034 |
->GGGTG |
Pathogenic |
Frameshift variant, coding sequence variant, genic downstream transcript variant |
rs1554865146 |
C>G |
Pathogenic |
Stop gained, coding sequence variant, genic downstream transcript variant |
rs1564706226 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant, genic downstream transcript variant |
rs1564706973 |
A>T |
Likely-pathogenic |
Stop gained, coding sequence variant, genic downstream transcript variant |
rs1564722420 |
C>T |
Likely-pathogenic |
Stop gained, coding sequence variant, genic downstream transcript variant |
rs1589813539 |
G>- |
Likely-pathogenic |
Genic downstream transcript variant, frameshift variant, coding sequence variant |
rs1589813731 |
->GG |
Pathogenic |
Genic downstream transcript variant, frameshift variant, coding sequence variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Transcription factors
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
GO ID |
Ontology |
Definition |
Evidence |
Reference |
GO:0000785 |
Component |
Chromatin |
ISA |
|
GO:0000976 |
Function |
Transcription regulatory region sequence-specific DNA binding |
IDA |
9178767, 16368682, 16735463, 19048125 |
GO:0000978 |
Function |
RNA polymerase II cis-regulatory region sequence-specific DNA binding |
IBA |
21873635 |
GO:0000981 |
Function |
DNA-binding transcription factor activity, RNA polymerase II-specific |
IBA |
21873635 |
GO:0000981 |
Function |
DNA-binding transcription factor activity, RNA polymerase II-specific |
ISA |
|
GO:0000987 |
Function |
Cis-regulatory region sequence-specific DNA binding |
IDA |
19118900 |
GO:0001655 |
Process |
Urogenital system development |
ISS |
|
GO:0001658 |
Process |
Branching involved in ureteric bud morphogenesis |
IEP |
1337742 |
GO:0001658 |
Process |
Branching involved in ureteric bud morphogenesis |
ISS |
|
GO:0001709 |
Process |
Cell fate determination |
ISS |
|
GO:0001823 |
Process |
Mesonephros development |
ISS |
|
GO:0001843 |
Process |
Neural tube closure |
ISS |
|
GO:0002072 |
Process |
Optic cup morphogenesis involved in camera-type eye development |
ISS |
|
GO:0003337 |
Process |
Mesenchymal to epithelial transition involved in metanephros morphogenesis |
ISS |
|
GO:0003406 |
Process |
Retinal pigment epithelium development |
ISS |
|
GO:0003677 |
Function |
DNA binding |
IDA |
24676634 |
GO:0003677 |
Function |
DNA binding |
ISS |
|
GO:0003700 |
Function |
DNA-binding transcription factor activity |
IMP |
11940591 |
GO:0005515 |
Function |
Protein binding |
IPI |
9178767, 15785774, 21575608 |
GO:0005634 |
Component |
Nucleus |
IDA |
19048125 |
GO:0005654 |
Component |
Nucleoplasm |
IDA |
|
GO:0005764 |
Component |
Lysosome |
IEA |
|
GO:0005815 |
Component |
Microtubule organizing center |
IDA |
18000879 |
GO:0006357 |
Process |
Regulation of transcription by RNA polymerase II |
IBA |
21873635 |
GO:0007409 |
Process |
Axonogenesis |
TAS |
9106533 |
GO:0007501 |
Process |
Mesodermal cell fate specification |
ISS |
|
GO:0007568 |
Process |
Aging |
IEA |
|
GO:0007601 |
Process |
Visual perception |
TAS |
9106533 |
GO:0008134 |
Function |
Transcription factor binding |
IPI |
24676634 |
GO:0010001 |
Process |
Glial cell differentiation |
ISS |
|
GO:0021554 |
Process |
Optic nerve development |
ISS |
|
GO:0021631 |
Process |
Optic nerve morphogenesis |
ISS |
|
GO:0021633 |
Process |
Optic nerve structural organization |
ISS |
|
GO:0021650 |
Process |
Vestibulocochlear nerve formation |
ISS |
|
GO:0031667 |
Process |
Response to nutrient levels |
IEA |
|
GO:0032991 |
Component |
Protein-containing complex |
ISS |
|
GO:0032993 |
Component |
Protein-DNA complex |
ISS |
|
GO:0034451 |
Component |
Centriolar satellite |
IDA |
18000879 |
GO:0035566 |
Process |
Regulation of metanephros size |
IMP |
17513325 |
GO:0035799 |
Process |
Ureter maturation |
ISS |
|
GO:0039003 |
Process |
Pronephric field specification |
ISS |
|
GO:0042472 |
Process |
Inner ear morphogenesis |
ISS |
|
GO:0043010 |
Process |
Camera-type eye development |
ISS |
|
GO:0043066 |
Process |
Negative regulation of apoptotic process |
IDA |
10980123 |
GO:0043066 |
Process |
Negative regulation of apoptotic process |
IMP |
17357786 |
GO:0043069 |
Process |
Negative regulation of programmed cell death |
ISS |
|
GO:0043154 |
Process |
Negative regulation of cysteine-type endopeptidase activity involved in apoptotic process |
IDA |
10980123, 17357786 |
GO:0043491 |
Process |
Protein kinase B signaling |
ISS |
|
GO:0045892 |
Process |
Negative regulation of transcription, DNA-templated |
IMP |
19118900 |
GO:0045893 |
Process |
Positive regulation of transcription, DNA-templated |
IDA |
16368682, 17357786, 19048125, 24676634 |
GO:0045893 |
Process |
Positive regulation of transcription, DNA-templated |
IMP |
11940591 |
GO:0045893 |
Process |
Positive regulation of transcription, DNA-templated |
ISS |
|
GO:0045944 |
Process |
Positive regulation of transcription by RNA polymerase II |
IDA |
16735463 |
GO:0045944 |
Process |
Positive regulation of transcription by RNA polymerase II |
ISS |
|
GO:0048793 |
Process |
Pronephros development |
ISS |
|
GO:0048854 |
Process |
Brain morphogenesis |
ISS |
|
GO:0048856 |
Process |
Anatomical structure development |
IBA |
21873635 |
GO:0048863 |
Process |
Stem cell differentiation |
ISS |
|
GO:0050679 |
Process |
Positive regulation of epithelial cell proliferation |
IDA |
17357786 |
GO:0060231 |
Process |
Mesenchymal to epithelial transition |
ISS |
|
GO:0061360 |
Process |
Optic chiasma development |
ISS |
|
GO:0070301 |
Process |
Cellular response to hydrogen peroxide |
ISS |
|
GO:0071300 |
Process |
Cellular response to retinoic acid |
ISS |
|
GO:0071333 |
Process |
Cellular response to glucose stimulus |
ISS |
|
GO:0071364 |
Process |
Cellular response to epidermal growth factor stimulus |
IEA |
|
GO:0072075 |
Process |
Metanephric mesenchyme development |
ISS |
|
GO:0072108 |
Process |
Positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis |
ISS |
|
GO:0072162 |
Process |
Metanephric mesenchymal cell differentiation |
ISS |
|
GO:0072179 |
Process |
Nephric duct formation |
ISS |
|
GO:0072189 |
Process |
Ureter development |
ISS |
|
GO:0072205 |
Process |
Metanephric collecting duct development |
ISS |
|
GO:0072207 |
Process |
Metanephric epithelium development |
IEP |
7856737 |
GO:0072221 |
Process |
Metanephric distal convoluted tubule development |
ISS |
|
GO:0072289 |
Process |
Metanephric nephron tubule formation |
ISS |
|
GO:0072300 |
Process |
Positive regulation of metanephric glomerulus development |
ISS |
|
GO:0072305 |
Process |
Negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis |
ISS |
|
GO:0072307 |
Process |
Regulation of metanephric nephron tubule epithelial cell differentiation |
ISS |
|
GO:0072593 |
Process |
Reactive oxygen species metabolic process |
ISS |
|
GO:0090102 |
Process |
Cochlea development |
ISS |
|
GO:0090103 |
Process |
Cochlea morphogenesis |
ISS |
|
GO:0090190 |
Process |
Positive regulation of branching involved in ureteric bud morphogenesis |
ISS |
|
GO:1900212 |
Process |
Negative regulation of mesenchymal cell apoptotic process involved in metanephros development |
ISS |
|
GO:1900215 |
Process |
Negative regulation of apoptotic process involved in metanephric collecting duct development |
ISS |
|
GO:1900218 |
Process |
Negative regulation of apoptotic process involved in metanephric nephron tubule development |
ISS |
|
GO:1990837 |
Function |
Sequence-specific double-stranded DNA binding |
IDA |
28473536 |
GO:2000378 |
Process |
Negative regulation of reactive oxygen species metabolic process |
IDA |
17357786 |
GO:2000594 |
Process |
Positive regulation of metanephric DCT cell differentiation |
ISS |
|
GO:2000597 |
Process |
Positive regulation of optic nerve formation |
ISS |
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
Q02962 |
Protein name |
Paired box protein Pax-2 |
Protein function |
Transcription factor that may have a role in kidney cell differentiation (PubMed:24676634). Has a critical role in the development of the urogenital tract, the eyes, and the CNS. |
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF00292 |
PAX |
16 → 140 |
|
Domain |
PF12403 |
Pax2_C |
304 → 416 |
Paired-box protein 2 C terminal |
Family |
|
Sequence |
|
Sequence length |
417 |
Interactions |
View interactions |
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Focal segmental glomerulosclerosis |
FOCAL SEGMENTAL GLOMERULOSCLEROSIS 7 |
rs267606877, rs267607183, rs267606878, rs267606879, rs267606880, rs121907909, rs74315343, rs121908415, rs121908416, rs121908417, rs1554181304, rs121434390, rs121434392, rs121434393, rs121434394, rs121434395, rs387906807, rs778868018, rs397517920, rs386833865, rs1131692055, rs587777741, rs1184529372, rs76492282, rs75462234, rs202128397, rs879255251, rs879255252, rs749740335, rs138656762, rs869025541, rs878853159, rs1393955970, rs748812981, rs1566778651, rs866294686, rs1566777560, rs1566778676, rs1568723797, rs1568725026, rs1569534160, rs1589475328, rs912928648, rs79555199, rs1595166085, rs1596351849, rs1596861969, rs1595163730, rs1588200023, rs779586424, rs759356936, rs1451194842, rs1317776692, rs759055242, rs2066568818 |
24676634, 26571382, 9916932 |
Hearing loss |
Sensorineural Hearing Loss (disorder) |
rs267607135, rs267606855, rs779841884, rs267606854, rs28942097, rs121908073, rs121908076, rs74315289, rs121908144, rs111033313, rs74315437, rs121908348, rs121908349, rs121908350, rs397515359, rs180177151, rs180177154, rs180177153, rs35689081, rs35887622, rs80338944, rs104894396, rs104894398, rs80338947, rs80338948, rs80338942, rs104894402, rs104894403, rs80338945, rs28931594, rs80338940, rs80338941, rs80356590, rs80338950, rs387906706, rs387906707, rs387906708, rs398122848, rs387907016, rs587776894, rs387907088, rs397515411, rs370965183, rs398122930, rs199897298, rs111033187, rs111033448, rs199606180, rs111033284, rs397516413, rs111033305, rs111033220, rs111033256, rs111033297, rs111033253, rs104894408, rs111033295, rs397516874, rs76434661, rs111033335, rs397517323, rs111033247, rs367928692, rs374793617, rs143939430, rs397515605, rs80338939, rs200656442, rs779748859, rs587781261, rs587781262, rs143343083, rs200147906, rs730880338, rs797044491, rs146281367, rs756484720, rs869025593, rs201306709, rs540895576, rs777777359, rs879255246, rs1554358720, rs142498437, rs377145777, rs1057517519, rs779077039, rs952741388, rs1060499797, rs764139009, rs1060499590, rs1064794012, rs1064797115, rs756790858, rs775633137, rs1554952443, rs1554952193, rs782063761, rs1199012623, rs756147087, rs1555648043, rs1555661490, rs1553196233, rs781546107, rs111033190, rs775428246, rs782539587, rs537227442, rs148695069, rs1554835827, rs953422571, rs1554834186, rs1554834161, rs1554835103, rs1554577339, rs1554577402, rs768471577, rs782279338, rs781951909, rs998045226, rs375759781, rs755804651, rs1557458426, rs767797828, rs538027448, rs1559366084, rs367688416, rs1558480402, rs1558490542, rs1559870857, rs1560690591, rs1561299289, rs1562817224, rs1562817529, rs1562822565, rs1562835391, rs1564113368, rs1564554255, rs773851192, rs1564555240, rs761261855, rs1564805114, rs1565522273, rs1565127413, rs781790246, rs1565430886, rs1565469959, rs746667217, rs1565819402, rs1565855932, rs150529554, rs1567939793, rs201866631, rs754472294, rs1559372512, rs1558464965, rs1558488902, rs775062249, rs1226171550, rs1561590396, rs765574676, rs762876554, rs757327146, rs1564949059, rs1565519673, rs368050948, rs1565541888, rs781989117, rs1565402473, rs750358148, rs1386887007, rs1209665716, rs1567641234, rs1237955948, rs1569042782, rs752672077, rs146689036, rs1560070780, rs149712664, rs1564556995, rs762226905, rs773573968, rs1568528171, rs1198256157, rs377267777, rs370564476, rs1577876794, rs747787770, rs759432278, rs1043716893, rs1581138934, rs2033773650, rs1421964916, rs771766431, rs780917129, rs1895773215, rs1895769400, rs761543680, rs1565920060 |
|
Kidney disease |
Chronic kidney disease stage 5 |
rs74315342, rs749740335, rs757649673, rs112417755, rs35138315 |
|
Mental retardation |
Intellectual Disability |
rs5742905, rs267607136, rs267607137, rs2131714307, rs267607038, rs267607042, rs80338685, rs137853127, rs80338815, rs28940893, rs387906309, rs121908096, rs121908099, rs587784365, rs121918315, rs121918316, rs397515320, rs121434489, rs1585215916, rs267607233, rs267606752, rs137852214, rs606231193, rs132630297, rs80338758, rs137852815, rs122455132, rs28935171, rs122453113, rs122445108, rs28934904, rs28934908, rs28935468, rs61748421, rs121918624, rs202060209, rs80338708, rs113994198, rs199422192, rs387906635, rs1554770064, rs1057519611, rs1060499526, rs387906636, rs1057519612, rs281875189, rs281875322, rs387906799, rs387906804, rs875989800, rs797045262, rs387906845, rs387906846, rs876657378, rs281875227, rs281875228, rs281875229, rs281875230, rs387906861, rs370667926, rs387906932, rs387906943, rs1557612719, rs387907190, rs387907191, rs2126499522, rs587776908, rs1560982564, rs80359505, rs398123009, rs587776929, rs587776930, rs397514555, rs398122824, rs398122825, rs397514556, rs2147483647, rs587776937, rs397514627, rs397514655, rs397514656, rs730882192, rs1587520018, rs1581995953, rs1554121970, rs1581987445, rs397514670, rs376395543, rs137854128, rs397509411, rs397509412, rs397514741, rs398122394, rs879255516, rs397518483, rs398122406, rs398122412, rs398123561, rs200667343, rs587777162, rs587777202, rs62507350, rs587777219, rs587777225, rs587777226, rs587779750, rs587777326, rs587777334, rs281875332, rs587780470, rs587780474, rs587780486, rs587777378, rs587777406, rs587777408, rs587777409, rs587777411, rs587777522, rs527236034, rs527236035, rs267608571, rs267608382, rs267608597, rs61753979, rs61751444, rs267608493, rs587777644, rs587777645, rs587777646, rs587777703, rs587779388, rs606231266, rs606231267, rs672601340, rs606231268, rs672601341, rs606231269, rs672601342, rs606231270, rs606231271, rs606231272, rs606231273, rs587784566, rs587784092, rs587783749, rs587783747, rs587783640, rs587783483, rs606231456, rs606231457, rs606231458, rs606231459, rs672601370, rs672601369, rs672601371, rs672601367, rs672601366, rs672601365, rs672601364, rs672601363, rs672601362, rs672601376, rs672601377, rs672601378, rs724159949, rs724159950, rs724159948, rs724159956, rs724159953, rs727502860, rs727502861, rs730882197, rs749995448, rs786205143, rs794726770, rs1135401808, rs786205583, rs786205595, rs786205859, rs794727792, rs794727928, rs794729221, rs797044519, rs797044523, rs797044521, rs797044524, rs797044526, rs797044522, rs797044520, rs794727642, rs796052719, rs781746113, rs796052510, rs796052733, rs796052724, rs796052728, rs796052676, rs796053353, rs796053366, rs796053368, rs1555103986, rs1555110818, rs796052571, rs1555110843, rs796052626, rs796052618, rs796053290, rs796052217, rs672601368, rs797045164, rs797044961, rs797044962, rs200070245, rs797044963, rs869320675, rs869320676, rs797045012, rs752746786, rs797044885, rs797044925, rs797044854, rs797044849, rs797044930, rs797044901, rs797044918, rs797044884, rs797045177, rs797045178, rs797045050, rs797045036, rs797045053, rs797045047, rs797045037, rs797045042, rs797045041, rs879255261, rs782397980, rs797045263, rs797045264, rs797045655, rs797045586, rs545185248, rs797046031, rs797046028, rs797046029, rs797046030, rs797045249, rs797045529, rs797045952, rs797045984, rs797045540, rs797045539, rs797045989, rs863224930, rs869025202, rs863225264, rs863225077, rs876661308, rs869025222, rs864309560, rs758252808, rs745756308, rs869025286, rs869025287, rs869025578, rs143038880, rs869025579, rs869025580, rs869025581, rs869312704, rs869312674, rs869312677, rs869312689, rs869312693, rs869312698, rs869312708, rs869312711, rs869312826, rs869312825, rs869312824, rs869312823, rs758432471, rs869312821, rs761993070, rs869312844, rs869312842, rs869312843, rs869312841, rs869312847, rs869320632, rs869312955, rs773432002, rs869320713, rs869320772, rs869320773, rs879255270, rs875989848, rs875989849, rs1716457622, rs2108414289, rs878854401, rs875989786, rs1085307109, rs1085307108, rs876657679, rs876661167, rs876661076, rs876661055, rs876661219, rs876661064, rs876661151, rs876661041, rs200440467, rs876661295, rs878853045, rs878853143, rs878853142, rs878853149, rs1555910048, rs878853152, rs878853146, rs878853145, rs878853141, rs878853151, rs878853144, rs878853148, rs878853147, rs878853251, rs878853269, rs879253762, rs886037841, rs879253888, rs879253931, rs879254016, rs879255618, rs879255619, rs879255620, rs886037847, rs879255621, rs886039332, rs746177928, rs886039520, rs886041003, rs886041058, rs750035706, rs886041059, rs886041060, rs886041061, rs886041090, rs886041088, rs886041089, rs886041095, rs886041097, rs886041989, rs886041944, rs886041692, rs886041593, rs886041687, rs886041207, rs886041309, rs886041239, rs886041448, rs138336847, rs149644940, rs886041295, rs886041521, rs886041125, rs886042041, rs886041238, rs886041469, rs886041197, rs886041291, rs886041658, rs886041705, rs886041876, rs139716296, rs1057516030, rs1057517408, rs749655461, rs141179774, rs370916968, rs1057517676, rs1057517933, rs1057517708, rs1057518352, rs1057518183, rs1057518474, rs1057518204, rs1057517825, rs1057518796, rs1057518961, rs1057518772, rs1057518988, rs1057519004, rs1057518700, rs772450541, rs371310428, rs1057519019, rs1057519491, rs1057519546, rs1057519560, rs1057519565, rs1057519400, rs1057519402, rs1057519405, rs1057519593, rs1057519594, rs1057519628, rs1556912828, rs1060505029, rs1060505030, rs147001633, rs1057519947, rs1057519617, rs1057524832, rs774592932, rs797045045, rs1039571136, rs1555910821, rs1060499626, rs1060499655, rs1554770185, rs1060499936, rs1060501153, rs1060501151, rs1064792984, rs1060503378, rs1060503386, rs1060503383, rs1060500046, rs1064792999, rs1060505033, rs1064796564, rs1064797002, rs1064793161, rs150802299, rs1064796830, rs1064794996, rs1064795444, rs1064796034, rs1064796403, rs1064794979, rs1064796765, rs1064793539, rs760933323, rs1064793546, rs1064796406, rs1064796367, rs780441716, rs1064794894, rs1064796023, rs1064797355, rs1085307484, rs1064794935, rs1085307547, rs1131690804, rs757511770, rs1131691875, rs1131691979, rs398122823, rs1131691866, rs1131692159, rs1131692228, rs1131692154, rs113331868, rs1554121872, rs1554121875, rs926027867, rs1554122123, rs1554122129, rs1287121256, rs1554122526, rs1554123982, rs1554385102, rs1554385111, rs1554385305, rs1554386687, rs1554389088, rs1554402092, rs1554434435, rs1135401778, rs1135401760, rs1135401770, rs1135401771, rs1135401768, rs1135401779, rs1135401805, rs1135401797, rs1135401799, rs1135401816, rs1135401823, rs1135401824, rs1555769968, rs1135401825, rs1135401955, rs1135401956, rs1135401957, rs1135401958, rs1554129040, rs1554150543, rs1553188463, rs1553146165, rs1485978447, rs1361547443, rs750079325, rs369692236, rs1554231836, rs749188610, rs1554122735, rs1554689877, rs1174482090, rs781053477, rs1554623112, rs1555409836, rs1555411305, rs770014321, rs1555984461, rs1555990958, rs762292772, rs1554944271, rs1057524157, rs1485749468, rs1555984343, rs1293450628, rs373584239, rs1553722309, rs1553738686, rs1376334317, rs1553722294, rs1553283831, rs1554120589, rs1555985554, rs1555877287, rs1555411378, rs750922282, rs1553264873, rs1554263326, rs1554264268, rs1554263626, rs1554263625, rs766614772, rs1553620494, rs1555050158, rs1555050165, rs1555050171, rs1555050174, rs765556214, rs1402086660, rs1554645052, rs1555661648, rs1293246328, rs749494995, rs775592405, rs1553265189, rs1553242856, rs1553247374, rs1553241570, rs1553997065, rs1553998565, rs1380822792, rs1555028154, rs1555023232, rs1553194155, rs1553130904, rs1553152590, rs1553567864, rs1553638614, rs120074160, rs1554486894, rs1554767754, rs1554843977, rs1555443581, rs1555443600, rs1555439545, rs1555525088, rs770680174, rs1555889130, rs373178770, rs1555985532, rs1553519853, rs781325598, rs1410587479, rs1553638086, rs150259543, rs1554093891, rs1554121228, rs1554120498, rs1554121189, rs1212517874, rs1554770628, rs1555979158, rs1554770054, rs771610568, rs1451230055, rs1554770624, rs1555906707, rs1555906768, rs1555906781, rs1555907620, rs1555907623, rs1555907626, rs1555907653, rs1555907864, rs1554094145, rs1554202698, rs1554200722, rs773327091, rs1555607621, rs1555604778, rs1555607159, rs1555607682, rs1553364018, rs1553324416, rs1555411394, rs1554102556, rs1554122363, rs1555705966, rs1555103971, rs1555408401, rs1554461593, rs1554304254, rs1554120978, rs1047509819, rs1555982601, rs767774867, rs1554789246, rs1555111511, rs1555950676, rs1555954380, rs1555985649, rs1553194162, rs1553518509, rs1274633498, rs1554274371, rs1554122252, rs1554122458, rs1554122729, rs1554297905, rs1554776342, rs1554770046, rs1554770667, rs1554792556, rs1452715535, rs1555444885, rs1555534147, rs1427624649, rs1555611722, rs1555744282, rs1555706391, rs1178702025, rs1555984102, rs1554770589, rs1554121443, rs1559791842, rs1559824939, rs1555889127, rs1236702036, rs1553510280, rs1553511175, rs1553511226, rs1554150552, rs1554275163, rs1554201137, rs1553517991, rs1553518511, rs1553517984, rs1553518752, rs1554119814, rs1554122293, rs1554122341, rs1554122689, rs1554770243, rs1554770444, rs1557045250, rs959316981, rs1556270312, rs1553270640, rs978179634, rs1554093884, rs1491240980, rs1555943484, rs1554121453, rs1334099693, rs1554048616, rs1555660806, rs1555644480, rs1555651572, rs1567844992, rs1567855081, rs1567855669, rs1567855704, rs1567856045, rs1567856331, rs1567860075, rs1567860112, rs1567860640, rs1567860891, rs754919272, rs1567860919, rs1567861468, rs1567861489, rs1567861501, rs1567861894, rs1567863732, rs1567864750, rs1567877108, rs1567878511, rs758785463, rs1553808301, rs1553245038, rs1553789166, rs1553813646, rs1553631860, rs1554121265, rs1554770262, rs1555034768, rs1555984433, rs779009256, rs1553994814, rs1553996086, rs1553996072, rs1553270599, rs1553153291, rs760262127, rs1554119274, rs1554121878, rs1554387293, rs1554385203, rs757077698, rs750612085, rs1554776500, rs1564360978, rs1554776933, rs1554776938, rs1565278132, rs1567368243, rs1558478047, rs375695605, rs1558479778, rs1558501648, rs1565240833, rs114727354, rs1557591264, rs1557620758, rs1559099927, rs1561788984, rs369459721, rs1563831738, rs1562159088, rs1562159562, rs1562159599, rs1559094754, rs1559328283, rs755634856, rs1561784687, rs1554122296, rs1561789313, rs1562720119, rs1564363665, rs1561697465, rs1561785003, rs1561787845, rs1561789215, rs1554122305, rs1561784553, rs1561784560, rs1561787690, rs1554122888, rs749632782, rs1567139896, rs1569370887, rs1569371303, rs1564493599, rs1561875779, rs1569146542, rs1569146649, rs1275489527, rs1560115921, rs1468772495, rs749969789, rs1560108090, rs1569376809, rs1569355102, rs1560103306, rs1564365418, rs1559855453, rs1562928193, rs1558149913, rs1253072668, rs141976414, rs1558371790, rs1557898800, rs1567758622, rs1567844041, rs1567844114, rs1567920106, rs1567920209, rs138247472, rs1567974030, rs1567995650, rs1283838287, rs1568003569, rs1568006217, rs1568018905, rs1562505675, rs1561783309, rs1555980234, rs1559087186, rs1560966086, rs1560330387, rs769471341, rs1562493608, rs1562505335, rs1554121861, rs1554122200, rs1562957809, rs1568097623, rs1391600900, rs1568234874, rs1568235086, rs1555990955, rs1567870541, rs1557570794, rs1562869207, rs1571818248, rs1431778557, rs369691608, rs1595808957, rs1597665063, rs1597846084, rs1603401125, rs1603350606, rs1601946481, rs1601932069, rs1602880906, rs1602308324, rs1574554519, rs1573882268, rs1603198937, rs1558148010, rs1558498928, rs1569459580, rs1569380375, rs1560062082, rs1557889974, rs1558414255, rs756429763, rs781663444, rs1569016820, rs1569017025, rs1569017160, rs1557612048, rs1568504941, rs1581987022, rs1576983339, rs1599892470, rs1265340906, rs1602284689, rs1574949440, rs1576220938, rs1576280892, rs1576288424, rs1574459612, rs1574511051, rs1575654528, rs1577094794, rs1294683568, rs771819481, rs1580984895, rs1581338441, rs1580988138, rs1581980317, rs1581986872, rs1554121207, rs1581987268, rs1581987476, rs1581987885, rs763770519, rs1581991929, rs1581992099, rs1581992998, rs1581995453, rs1554122242, rs1581996778, rs1581997228, rs1588735247, rs1555980467, rs1555985742, rs1601319086, rs1601970168, rs1574451881, rs876661168, rs1576994053, rs1573589807, rs1581036396, rs1601267617, rs1572531830, rs1573483715, rs1590954686, rs1601315812, rs1573965358, rs1573972562, rs529087882, rs1570609440, rs1598940393, rs1575333081, rs1576028676, rs1596476657, rs1599375711, rs1603290366, rs1603060007, rs1603069440, rs1592939069, rs1591612223, rs2062994512, rs373701249, rs1600471396, rs1600501018, rs1600504088, rs1600514073, rs748436953, rs765723607, rs758170522, rs1561785045, rs1357591960, rs1591609136, rs1596891223, rs1579370234, rs2047850664, rs1579109565, rs1870202051, rs1574887674, rs778229060, rs1572531281, rs1570622663, rs1573501865, rs1576086299, rs1576164991, rs1574907198, rs1576656734, rs1554121438, rs1581995425, rs1581996813, rs1582001015, rs1588324025, rs1591371152, rs1590008294, rs1590956245, rs1590028691, rs1591606580, rs1591611001, rs1591612317, rs1591612370, rs763436882, rs997044541, rs1595897117, rs747706524, rs1579377990, rs1201878175, rs1894051550, rs1572531730, rs1579576029, rs1577017863, rs752545577, rs1582461267, rs1589460606, rs1588727276, rs1598620094, rs1599368323, rs1600082188, rs1601319352, rs1598226304, rs2076013475, rs2076017638, rs1600596180, rs1554121932, rs1680676671, rs1570607996, rs1382444181, rs1570640673, rs1574994308, rs1596667777, rs1602226289, rs1595629181, rs1595609005, rs1227643933, rs1572705473, rs1570621899, rs1722830922, rs1575094649, rs1417035592, rs1581997098, rs1589457762, rs1598211790, rs758726258, rs1601071971, rs863224922, rs1586692481, rs1586692548, rs1586692551, rs1580988074, rs1594129609, rs1588732344, rs1579368865, rs1586660389, rs1586660370, rs1586660338, rs1586657848, rs1586660381, rs1791701214, rs752676391, rs1680673822, rs758098717, rs1726676630, rs762288077, rs1759964009, rs1760905766, rs1761021165, rs1554121934, rs2055849544, rs1049773, rs587784300, rs1861628072, rs1761241410, rs1064797322, rs1948652423, rs2059194330, rs1777174302, rs2054280202, rs2081190512, rs772665884, rs1400164869, rs1861593395, rs1760897843, rs1761087122, rs1388355040, rs2068797192, rs1777175608, rs376898131 |
|
Microphthalmos |
Microphthalmos |
rs794726862, rs1329285216 |
|
Multiple congenital anomalies |
Multiple congenital anomalies |
rs1057517732 |
24676634 |
Myopia |
Myopia |
rs387907109, rs146936371, rs587776903, rs786205127, rs398122836, rs199624584, rs587777625, rs786205216, rs758872875, rs764211125, rs1135402746, rs765658563, rs1555941129, rs1555941116, rs199923805, rs782555528, rs1554862601, rs1586620121, rs1387950081, rs2051026773, rs1422332023 |
|
Nephrotic syndrome |
Nephrotic Syndrome |
rs876657369, rs121912601, rs121912602, rs876657370, rs121912603, rs121912604, rs121912605, rs121907900, rs121907901, rs28941778, rs587776576, rs28942089, rs587776577, rs28941777, rs121907910, rs1568296260, rs119473033, rs74315342, rs74315343, rs74315345, rs74315346, rs74315347, rs74315348, rs121434394, rs267606919, rs121912488, rs267606953, rs267606954, rs267606955, rs104886210, rs1591732280, rs1591750243, rs140511594, rs140781106, rs147972030, rs587776969, rs386833863, rs386833880, rs386833882, rs386833892, rs386833895, rs386833909, rs386833911, rs386833920, rs386833935, rs386833947, rs1555763603, rs398122978, rs398122979, rs398122980, rs369573693, rs398122981, rs398122982, rs398122983, rs200482683, rs730882194, rs180177201, rs587777552, rs587777553, rs775170915, rs749740335, rs12568913, rs530318579, rs786204583, rs786204708, rs786204632, rs138656762, rs797044992, rs797044994, rs797044995, rs864321632, rs864321687, rs864321688, rs864321633, rs869025495, rs869025541, rs869312747, rs145473779, rs757674160, rs869320695, rs138909849, rs869312984, rs1057516900, rs763818901, rs199506378, rs1057517164, rs1057516523, rs1057516414, rs778055996, rs1057516395, rs1057516747, rs1057516880, rs1057516680, rs778217926, rs1057519347, rs764587648, rs1060499703, rs121907903, rs769259446, rs1131692252, rs1131692253, rs1131692254, rs1131692255, rs1131692256, rs746887949, rs1131692235, rs1135402911, rs1135402912, rs1135402913, rs1554946480, rs1555331969, rs773173317, rs1555816634, rs775006954, rs1320543506, rs534522842, rs1272948499, rs1191455921, rs1291398331, rs1554939785, rs776016942, rs1031744496, rs748812981, rs755972674, rs1553312833, rs967339926, rs1462028977, rs1212702104, rs1167223941, rs762631237, rs1553316575, rs1553315173, rs1553316648, rs1553316611, rs780761368, rs368572297, rs1568070817, rs1321552081, rs1558108130, rs1558091788, rs1565707103, rs1558355124, rs1564622701, rs1351580598, rs1589475328, rs1589413498, rs1572255744, rs1572262824, rs761410195, rs1602413491, rs1590326226, rs375998390, rs570583897, rs369363545, rs201488687, rs1334894971, rs763782471, rs138047529, rs895782232, rs1572255047, rs1589433172, rs1589509476, rs1572277600, rs1572282458, rs1584675898, rs759043857, rs1853443391 |
|
Nystagmus |
Nystagmus |
rs137852207, rs137852208, rs1928435502, rs137852209, rs137852210, rs1929191668, rs137852211, rs137852212, rs2124209414, rs387906720, rs387906721, rs1602791884, rs786205896 |
|
Renal coloboma syndrome |
Papillorenal syndrome, Renal coloboma syndrome |
rs77777862, rs76675173, rs79555199, rs387906530, rs75462234, rs78122364, rs104894170, rs76492282, rs75399846, rs1589813539, rs759356936 |
22213154, 24676634, 10533062, 9760197, 19954729, 8589702, 15652857, 27657687, 11168927, 9916932 |
Renal dysplasia |
Renal Cell Dysplasia, Renal dysplasia |
rs387907123 |
|
Renal insufficiency |
Renal Insufficiency |
rs1596536873 |
|
Vesicoureteral reflux |
Vesico-Ureteral Reflux |
rs587777684, rs148731211 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Allanson pantzar mcleod syndrome |
Allanson Pantzar McLeod syndrome |
|
27657687 |
Arnold-chiari malformation |
Arnold-Chiari Malformation, Type I |
|
|
Bilateral renal hypoplasia |
Bilateral renal hypoplasia |
|
22138676, 23539225, 11461952, 17513325 |
Cardiovascular diseases |
Cardiovascular Diseases |
|
30595370 |
Chorioretinal atrophy |
Chorioretinal atrophy |
|
|
Coloboma of optic disc |
Coloboma of optic disc |
|
26571382 |
Endometrioma |
Endometrioma |
|
22473392 |
Endometriosis |
Endometriosis |
rs1800629, rs1143634 |
22473392 |
Female urogenital diseases |
Female Urogenital Diseases |
|
16002989 |
Fundus coloboma |
Fundus coloboma |
|
|
Genetic steroid-resistant nephrotic syndrome |
Genetic steroid-resistant nephrotic syndrome |
|
|
Glomerular hyalinosis |
Hyalinosis, Segmental Glomerular |
|
|
Glomerulosclerosis |
Focal glomerulosclerosis |
|
|
Kidney failure |
Kidney Failure, Chronic |
|
16631587 |
Morning glory anomaly |
Morning glory anomaly |
|
|
Multicystic renal dysplasia |
Multicystic Dysplastic Kidney |
|
|
Nephritis |
NEPHROTIC SYNDROME, STEROID-RESISTANT, AUTOSOMAL RECESSIVE |
|
24676634 |
Orbital cyst |
Orbital cyst |
|
|
Renal glomerular disease |
Renal glomerular disease |
|
|
Renal hypoplasia |
Congenital hypoplasia of kidney, Renal hypoplasia, bilateral, RENAL HYPOPLASIA, ISOLATED (disorder) |
rs561111097 |
|
Retinal coloboma |
Coloboma of the Retina |
|
|
Strabismus |
Strabismus |
|
|
|
|
|