SERPINC1 (serpin family C member 1)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
462 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Serpin family C member 1 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
SERPINC1 |
SynonymsGene synonyms aliases
|
AT3, AT3D, ATIII, ATIII-R2, ATIII-T1, ATIII-T2, THPH7 |
ChromosomeChromosome number
|
1 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
1q25.1 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
The protein encoded by this gene, antithrombin III, is a plasma protease inhibitor and a member of the serpin superfamily. This protein inhibits thrombin as well as other activated serine proteases of the coagulation system, and it regulates the blood coa |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs2227624 |
A>T |
Conflicting-interpretations-of-pathogenicity, uncertain-significance |
5 prime UTR variant, coding sequence variant, missense variant |
rs28929469 |
G>A |
Pathogenic, likely-pathogenic |
Coding sequence variant, missense variant |
rs121909547 |
G>A,T |
Likely-pathogenic, pathogenic |
Missense variant, coding sequence variant |
rs121909551 |
G>A |
Pathogenic-likely-pathogenic, likely-benign |
Missense variant, coding sequence variant |
rs121909552 |
C>T |
Conflicting-interpretations-of-pathogenicity, likely-benign |
Missense variant, coding sequence variant |
rs121909558 |
A>T |
Pathogenic |
5 prime UTR variant, missense variant, coding sequence variant |
rs121909560 |
CT>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs121909561 |
TCCA>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs121909562 |
G>A |
Pathogenic |
Stop gained, coding sequence variant |
rs121909563 |
C>A,T |
Pathogenic, uncertain-significance |
Missense variant, coding sequence variant |
rs121909565 |
A>G |
Pathogenic |
Missense variant, coding sequence variant |
rs121909567 |
G>A |
Likely-pathogenic, pathogenic |
Missense variant, coding sequence variant |
rs121909569 |
A>G |
Pathogenic |
Missense variant, coding sequence variant |
rs121909570 |
T>C,G |
Pathogenic |
Missense variant, coding sequence variant |
rs121909571 |
T>C |
Pathogenic |
Missense variant, coding sequence variant |
rs121909572 |
A>G |
Pathogenic |
Missense variant, coding sequence variant |
rs121909573 |
A>G |
Pathogenic |
Missense variant, coding sequence variant |
rs387906575 |
A>G |
Pathogenic |
Coding sequence variant, 5 prime UTR variant, missense variant |
rs542881762 |
C>G,T |
Likely-pathogenic |
Intron variant |
rs786204063 |
AAG>- |
Pathogenic |
Coding sequence variant, inframe deletion |
rs863224495 |
G>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1131691435 |
T>C |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs1460568494 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs1557904209 |
C>A |
Likely-pathogenic |
Stop gained, coding sequence variant |
rs1572086894 |
TTCATGCATCTCCTTTCTGTACCCTAAGAGAGTGGGGAAGGTGTACTCACCTCAAGAAATGCCTTATGGAATGCATCTGAGACATAGAGGTCATCTCGGCCTTCTGCAACAATACCTGGAAGGAAGACCGGAGAAGTCTTTGTGAGATGGGAGAAAGTTGGCTTC>- |
Likely-pathogenic |
Splice donor variant, intron variant, splice acceptor variant, coding sequence variant |
rs1572088348 |
C>A |
Likely-pathogenic |
Intron variant |
rs1572088775 |
T>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1572088823 |
CTTCC>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1572088837 |
->T |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1572088853 |
C>- |
Likely-pathogenic |
Coding sequence variant, stop gained |
rs1572088865 |
G>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1572090079 |
C>T |
Pathogenic |
Splice donor variant |
rs1572090114 |
A>G |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1572090173 |
G>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1572090305 |
->G |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1572090368 |
CTTAAA>- |
Pathogenic |
Coding sequence variant, inframe deletion |
rs1572091783 |
G>- |
Likely-pathogenic |
Coding sequence variant, stop gained |
rs1572091831 |
AAAATG>- |
Likely-pathogenic |
Coding sequence variant, inframe deletion |
rs1572092076 |
->G |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1572092099 |
G>T |
Pathogenic |
Coding sequence variant, stop gained |
rs1572092103 |
A>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1572092195 |
C>G |
Likely-pathogenic |
Splice acceptor variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Transcription factors
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P01008 |
Protein name |
Antithrombin-III (ATIII) (Serpin C1) |
Protein function |
Most important serine protease inhibitor in plasma that regulates the blood coagulation cascade (PubMed:15140129, PubMed:15853774). AT-III inhibits thrombin, matriptase-3/TMPRSS7, as well as factors IXa, Xa and XIa (PubMed:15140129). Its inhibit |
PDB |
1ANT
,
1ATH
,
1AZX
,
1BR8
,
1DZG
,
1DZH
,
1E03
,
1E04
,
1E05
,
1JVQ
,
1LK6
,
1NQ9
,
1OYH
,
1R1L
,
1SR5
,
1T1F
,
1TB6
,
2ANT
,
2B4X
,
2B5T
,
2BEH
,
2GD4
,
2HIJ
,
2ZNH
,
3EVJ
,
3KCG
,
4EB1
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF00079 |
Serpin |
85 → 461 |
Serpin (serine protease inhibitor) |
Domain |
|
Sequence |
|
Sequence length |
464 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Antithrombin deficiency |
Antithrombin III Deficiency, Hereditary Antithrombin Deficiency |
rs121909546, rs121909547, rs121909548, rs121909549, rs121909550, rs121909551, rs2227624, rs121909552, rs121909554, rs121909555, rs121909557, rs121909558, rs28929469, rs1572088837, rs121909560, rs121909561, rs121909562, rs121909563, rs121909564, rs121909567, rs2102789885, rs2102784614, rs2102778876, rs121909569, rs387906575, rs121909570, rs121909571, rs121909572, rs121909573, rs2102773181, rs2102772927, rs483352856, rs483352854, rs786204063, rs863224495, rs542881762, rs758087836, rs1487411568, rs1460568494, rs1572088775, rs1572088823, rs1572088853, rs1572090173, rs1572091783, rs1572091831, rs1572092076, rs1572092103, rs1572086894, rs1572088865, rs765445413, rs1572090305, rs1572090368, rs1572088348, rs1572090079, rs1449772752, rs1657909645 |
7959685, 2013320, 1906811, 3179438, 16620552, 24956267, 26748602, 9845533, 6582486, 11794707, 10997988, 7832187, 16908819, 7994035, 12595305, 15164384, 28317092, 7981186, 3080419, 9031473, 8274732, 2365065, 2794060, 2229057, 27322195, 28300866, 24082793, 12894857, 31064749, 23910795, 3805013, 6435583, 9157604, 12353073, 7878627, 1547341, 1469094, 24684277, 1873224, 2615648, 24162787, 11713457, 8443391, 1555650, 3191114, 2781509, 21325262, 7734359, 7989582, 3162733, 8486379, 9759613, 6435583 |
Hereditary thrombophilia |
Hereditary thrombophilia due to congenital antithrombin deficiency |
rs121918146, rs121918122, rs761776963 |
|
Liver failure |
Liver Failure, Acute |
rs118203990, rs118203991, rs118203992, rs387907022, rs201861847, rs796065037, rs759315662, rs368196005, rs796052121, rs369437593, rs367683258, rs766314948, rs368085185, rs770446752, rs753039116, rs776797592, rs1490906786, rs1562849964, rs759960319, rs776597537, rs375350359, rs1573008071, rs1601977105, rs1174791046, rs1019313682 |
4089794 |
Nephrotic syndrome |
Nephrotic Syndrome |
rs876657369, rs121912601, rs121912602, rs876657370, rs121912603, rs121912604, rs121912605, rs121907900, rs121907901, rs28941778, rs587776576, rs28942089, rs587776577, rs28941777, rs121907910, rs1568296260, rs119473033, rs74315342, rs74315343, rs74315345, rs74315346, rs74315347, rs74315348, rs121434394, rs267606919, rs121912488, rs267606953, rs267606954, rs267606955, rs104886210, rs1591732280, rs1591750243, rs140511594, rs140781106, rs147972030, rs587776969, rs386833863, rs386833880, rs386833882, rs386833892, rs386833895, rs386833909, rs386833911, rs386833920, rs386833935, rs386833947, rs1555763603, rs398122978, rs398122979, rs398122980, rs369573693, rs398122981, rs398122982, rs398122983, rs200482683, rs730882194, rs180177201, rs587777552, rs587777553, rs775170915, rs749740335, rs12568913, rs530318579, rs786204583, rs786204708, rs786204632, rs138656762, rs797044992, rs797044994, rs797044995, rs864321632, rs864321687, rs864321688, rs864321633, rs869025495, rs869025541, rs869312747, rs145473779, rs757674160, rs869320695, rs138909849, rs869312984, rs1057516900, rs763818901, rs199506378, rs1057517164, rs1057516523, rs1057516414, rs778055996, rs1057516395, rs1057516747, rs1057516880, rs1057516680, rs778217926, rs1057519347, rs764587648, rs1060499703, rs121907903, rs769259446, rs1131692252, rs1131692253, rs1131692254, rs1131692255, rs1131692256, rs746887949, rs1131692235, rs1135402911, rs1135402912, rs1135402913, rs1554946480, rs1555331969, rs773173317, rs1555816634, rs775006954, rs1320543506, rs534522842, rs1272948499, rs1191455921, rs1291398331, rs1554939785, rs776016942, rs1031744496, rs748812981, rs755972674, rs1553312833, rs967339926, rs1462028977, rs1212702104, rs1167223941, rs762631237, rs1553316575, rs1553315173, rs1553316648, rs1553316611, rs780761368, rs368572297, rs1568070817, rs1321552081, rs1558108130, rs1558091788, rs1565707103, rs1558355124, rs1564622701, rs1351580598, rs1589475328, rs1589413498, rs1572255744, rs1572262824, rs761410195, rs1602413491, rs1590326226, rs375998390, rs570583897, rs369363545, rs201488687, rs1334894971, rs763782471, rs138047529, rs895782232, rs1572255047, rs1589433172, rs1589509476, rs1572277600, rs1572282458, rs1584675898, rs759043857, rs1853443391 |
11304663 |
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Blood coagulation disorders |
Blood Coagulation Disorders |
|
62897 |
Cerebral thrombosis |
Cerebral Thrombosis, Brain Thrombosis |
|
6636041 |
Cerebral thrombus |
Brain Thrombus, Cerebral Thrombus |
|
6636041 |
Coronary syndrome |
Acute Coronary Syndrome |
rs4986893 |
7923645 |
Disseminated intravascular coagulation |
Disseminated Intravascular Coagulation |
|
8810955, 9637888, 6233579 |
Hepatic vein thrombosis |
Hepatic Vein Thrombosis |
|
|
Intracranial thrombosis |
Intracranial Thrombosis |
|
6636041 |
Portal vein thrombosis |
Portal Vein Thrombosis |
|
|
Respiratory distress syndrome |
Respiratory Distress Syndrome, Adult |
|
8810955 |
Retinal vein occlusion |
Retinal Vein Occlusion |
|
|
Superficial thrombophlebitis |
Superficial Thrombophlebitis |
|
|
Thrombosis |
Deep Vein Thrombosis, Thrombosis of cerebral veins |
|
55783, 31064749, 6435583, 8810955 |
|
|
|