ASS1 (argininosuccinate synthase 1)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
445 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Argininosuccinate synthase 1 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
ASS1 |
SynonymsGene synonyms aliases
|
ASS, CTLN1 |
ChromosomeChromosome number
|
9 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
9q34.11 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromoso |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs35269064 |
G>A,T |
Pathogenic, likely-benign, benign |
Missense variant, coding sequence variant |
rs121908636 |
G>A |
Pathogenic-likely-pathogenic |
Coding sequence variant, missense variant |
rs121908637 |
G>A |
Pathogenic, uncertain-significance |
Coding sequence variant, missense variant |
rs121908638 |
G>A,T |
Conflicting-interpretations-of-pathogenicity, pathogenic, pathogenic-likely-pathogenic |
Coding sequence variant, missense variant |
rs121908639 |
G>A,T |
Pathogenic-likely-pathogenic |
Coding sequence variant, missense variant |
rs121908642 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs121908643 |
C>T |
Conflicting-interpretations-of-pathogenicity |
Coding sequence variant, missense variant |
rs121908644 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs121908645 |
C>T |
Pathogenic-likely-pathogenic |
Coding sequence variant, stop gained |
rs121908646 |
T>C |
Pathogenic |
Coding sequence variant, missense variant |
rs138350285 |
C>G,T |
Likely-pathogenic, uncertain-significance |
Coding sequence variant, synonymous variant, 5 prime UTR variant, missense variant |
rs148918985 |
C>T |
Pathogenic |
Missense variant, coding sequence variant |
rs183276875 |
C>T |
Conflicting-interpretations-of-pathogenicity, likely-pathogenic |
Missense variant, coding sequence variant |
rs192838388 |
G>A |
Pathogenic-likely-pathogenic, pathogenic |
Missense variant, coding sequence variant |
rs199751308 |
A>G |
Conflicting-interpretations-of-pathogenicity, likely-pathogenic |
Missense variant, coding sequence variant |
rs200527708 |
C>T |
Conflicting-interpretations-of-pathogenicity |
Intron variant |
rs370595480 |
G>A |
Conflicting-interpretations-of-pathogenicity |
Missense variant, coding sequence variant |
rs371265106 |
G>A |
Pathogenic-likely-pathogenic, likely-pathogenic |
Missense variant, coding sequence variant |
rs372128852 |
G>A |
Pathogenic-likely-pathogenic, pathogenic |
Intron variant |
rs374586230 |
A>C,T |
Pathogenic |
Splice acceptor variant |
rs375579096 |
C>T |
Likely-benign, conflicting-interpretations-of-pathogenicity |
Synonymous variant, coding sequence variant |
rs376371866 |
C>A,T |
Uncertain-significance, conflicting-interpretations-of-pathogenicity |
Missense variant, coding sequence variant |
rs398123130 |
A>G |
Pathogenic, likely-pathogenic |
Splice acceptor variant |
rs398123131 |
G>A |
Pathogenic, likely-pathogenic |
Missense variant, coding sequence variant |
rs575001023 |
G>A |
Pathogenic |
Missense variant, coding sequence variant |
rs745404241 |
G>A,T |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs748264993 |
G>A,T |
Pathogenic-likely-pathogenic |
Splice donor variant |
rs750214431 |
G>T |
Pathogenic-likely-pathogenic |
Splice donor variant |
rs750780742 |
A>G |
Likely-pathogenic |
Initiator codon variant, missense variant, coding sequence variant |
rs751930594 |
A>C,G,T |
Pathogenic |
Splice acceptor variant |
rs762387914 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs763389916 |
C>T |
Likely-pathogenic |
Intron variant |
rs765338121 |
G>A |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs770362721 |
G>- |
Pathogenic-likely-pathogenic |
Coding sequence variant, frameshift variant |
rs770585183 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs770944877 |
G>A |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs771794639 |
C>G,T |
Uncertain-significance, likely-pathogenic |
Coding sequence variant, missense variant |
rs775305020 |
G>A |
Pathogenic |
Coding sequence variant, missense variant |
rs775791516 |
T>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs777828000 |
G>A |
Pathogenic-likely-pathogenic |
Coding sequence variant, missense variant |
rs786204648 |
CT>- |
Pathogenic-likely-pathogenic |
Coding sequence variant, frameshift variant |
rs796051936 |
T>C |
Uncertain-significance, likely-pathogenic |
Coding sequence variant, missense variant |
rs886039853 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs895822620 |
C>A,T |
Uncertain-significance, conflicting-interpretations-of-pathogenicity |
Coding sequence variant, missense variant |
rs936192871 |
G>A |
Pathogenic |
Missense variant, coding sequence variant |
rs982830431 |
G>A |
Pathogenic-likely-pathogenic |
Splice donor variant |
rs1004492719 |
TTCAAGGG>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
rs1043964127 |
C>A |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1057516339 |
C>T |
Likely-pathogenic |
Coding sequence variant, stop gained |
rs1057516544 |
G>- |
Likely-pathogenic |
Coding sequence variant, splice acceptor variant |
rs1057516648 |
G>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1057516960 |
G>A |
Likely-pathogenic |
Initiator codon variant, coding sequence variant, missense variant |
rs1057517259 |
G>T |
Likely-pathogenic |
Splice acceptor variant |
rs1057520659 |
G>T |
Pathogenic |
Splice donor variant |
rs1085307056 |
G>C |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1301613270 |
C>G,T |
Pathogenic-likely-pathogenic |
Missense variant, coding sequence variant, stop gained |
rs1313340299 |
->G |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1396766124 |
G>A |
Likely-pathogenic |
Splice donor variant |
rs1554722453 |
CACATCAGGTAAATCCCACCC>- |
Likely-pathogenic |
Coding sequence variant, splice donor variant, intron variant |
rs1554723160 |
GTATG>- |
Likely-pathogenic |
Coding sequence variant, splice donor variant, intron variant |
rs1554723625 |
G>T |
Likely-pathogenic |
Coding sequence variant, stop gained |
rs1554982237 |
G>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1554982243 |
->A |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1554982809 |
G>A |
Likely-pathogenic |
Splice acceptor variant |
rs1554982847 |
C>A |
Likely-pathogenic |
Coding sequence variant, stop gained |
rs1554983717 |
->C |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1554983719 |
G>A |
Likely-pathogenic |
Splice donor variant |
rs1564903969 |
C>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1588475891 |
C>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1588495489 |
C>A,T |
Likely-pathogenic, likely-benign |
Coding sequence variant, stop gained, synonymous variant |
rs1588496214 |
A>G |
Pathogenic |
Splice acceptor variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Transcription factors
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
GO ID |
Ontology |
Definition |
Evidence |
Reference |
GO:0000050 |
Process |
Urea cycle |
IBA |
21873635 |
GO:0000050 |
Process |
Urea cycle |
IEA |
|
GO:0000050 |
Process |
Urea cycle |
IMP |
7977368, 8792870, 18473344, 27287393 |
GO:0000050 |
Process |
Urea cycle |
TAS |
|
GO:0000052 |
Process |
Citrulline metabolic process |
IMP |
7977368 |
GO:0000053 |
Process |
Argininosuccinate metabolic process |
IBA |
21873635 |
GO:0000053 |
Process |
Argininosuccinate metabolic process |
IMP |
7977368 |
GO:0001822 |
Process |
Kidney development |
IEA |
|
GO:0001889 |
Process |
Liver development |
IEA |
|
GO:0003723 |
Function |
RNA binding |
HDA |
22658674 |
GO:0004055 |
Function |
Argininosuccinate synthase activity |
IBA |
21873635 |
GO:0004055 |
Function |
Argininosuccinate synthase activity |
IMP |
7977368, 8792870, 18473344, 27287393, 28985504 |
GO:0005515 |
Function |
Protein binding |
IPI |
12620389, 17496144, 28587924, 28985504 |
GO:0005524 |
Function |
ATP binding |
IEA |
|
GO:0005634 |
Component |
Nucleus |
IEA |
|
GO:0005737 |
Component |
Cytoplasm |
IBA |
21873635 |
GO:0005741 |
Component |
Mitochondrial outer membrane |
IEA |
|
GO:0005764 |
Component |
Lysosome |
IEA |
|
GO:0005783 |
Component |
Endoplasmic reticulum |
IEA |
|
GO:0005829 |
Component |
Cytosol |
IDA |
28985504 |
GO:0005829 |
Component |
Cytosol |
TAS |
|
GO:0006526 |
Process |
Arginine biosynthetic process |
IBA |
21873635 |
GO:0006526 |
Process |
Arginine biosynthetic process |
IEA |
|
GO:0006526 |
Process |
Arginine biosynthetic process |
IMP |
8792870, 18473344, 27287393 |
GO:0006531 |
Process |
Aspartate metabolic process |
IMP |
7977368 |
GO:0006953 |
Process |
Acute-phase response |
IEA |
|
GO:0007494 |
Process |
Midgut development |
IEA |
|
GO:0007568 |
Process |
Aging |
IEA |
|
GO:0007584 |
Process |
Response to nutrient |
IEA |
|
GO:0007623 |
Process |
Circadian rhythm |
IDA |
28985504 |
GO:0010043 |
Process |
Response to zinc ion |
IEA |
|
GO:0010046 |
Process |
Response to mycotoxin |
IEA |
|
GO:0015643 |
Function |
Toxic substance binding |
IEA |
|
GO:0016597 |
Function |
Amino acid binding |
IMP |
7977368 |
GO:0032355 |
Process |
Response to estradiol |
IEA |
|
GO:0042493 |
Process |
Response to drug |
IEA |
|
GO:0042802 |
Function |
Identical protein binding |
IPI |
16189514, 21988832, 25416956 |
GO:0043204 |
Component |
Perikaryon |
IEA |
|
GO:0045429 |
Process |
Positive regulation of nitric oxide biosynthetic process |
IMP |
21106532 |
GO:0060416 |
Process |
Response to growth hormone |
IEA |
|
GO:0060539 |
Process |
Diaphragm development |
IEA |
|
GO:0070062 |
Component |
Extracellular exosome |
HDA |
19056867, 23533145 |
GO:0070852 |
Component |
Cell body fiber |
IEA |
|
GO:0071222 |
Process |
Cellular response to lipopolysaccharide |
IEA |
|
GO:0071230 |
Process |
Cellular response to amino acid stimulus |
IEA |
|
GO:0071242 |
Process |
Cellular response to ammonium ion |
IEA |
|
GO:0071320 |
Process |
Cellular response to cAMP |
IEA |
|
GO:0071346 |
Process |
Cellular response to interferon-gamma |
IEA |
|
GO:0071356 |
Process |
Cellular response to tumor necrosis factor |
IEA |
|
GO:0071377 |
Process |
Cellular response to glucagon stimulus |
IEA |
|
GO:0071400 |
Process |
Cellular response to oleic acid |
IEA |
|
GO:0071418 |
Process |
Cellular response to amine stimulus |
IEA |
|
GO:0071499 |
Process |
Cellular response to laminar fluid shear stress |
IMP |
21106532 |
GO:0071549 |
Process |
Cellular response to dexamethasone stimulus |
IEA |
|
GO:1903038 |
Process |
Negative regulation of leukocyte cell-cell adhesion |
IMP |
21106532 |
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P00966 |
Protein name |
Argininosuccinate synthase (EC 6.3.4.5) (Citrulline--aspartate ligase) |
Protein function |
One of the enzymes of the urea cycle, the metabolic pathway transforming neurotoxic amonia produced by protein catabolism into inocuous urea in the liver of ureotelic animals. Catalyzes the formation of arginosuccinate from aspartate, citrulline |
PDB |
2NZ2
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF00764 |
Arginosuc_synth |
8 → 403 |
Arginosuccinate synthase |
Family |
|
Sequence |
|
Sequence length |
412 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Citrullinemia |
Citrullinemia, Argininosuccinic Acid Synthetase Deficiency, Complete, Citrullinemia Type 1, Acute neonatal citrullinemia type I, Adult-onset citrullinemia type I |
rs80338722, rs80338725, rs80338719, rs80338723, rs80338726, rs121908636, rs121908638, rs121908639, rs121908640, rs121908641, rs121908642, rs121908643, rs121908644, rs121908645, rs121908646, rs121908647, rs80338721, rs80338724, rs80338715, rs80338727, rs80338729, rs80338716, rs80338717, rs398122839, rs398123130, rs192838388, rs148918985, rs398123131, rs371265106, rs727503814, rs786204648, rs770362721, rs786204537, rs786204460, rs751930594, rs771937610, rs777828000, rs80338720, rs1085307056, rs746155190, rs575001023, rs763389916, rs886039853, rs372128852, rs1057516960, rs1057516648, rs1057516544, rs1057516339, rs1057517259, rs982830431, rs762387914, rs1057516338, rs1057517402, rs763191789, rs1057520659, rs1060499612, rs765338121, rs758827458, rs1554725034, rs1439911743, rs936192871, rs1554725677, rs1554982237, rs756859126, rs1554982809, rs1554983719, rs1396766124, rs750780742, rs1554982824, rs1554722453, rs1554723160, rs1554723625, rs1554725033, rs1554982243, rs770944877, rs750214431, rs1213378896, rs1554982847, rs201623252, rs1554983717, rs1301613270, rs775791516, rs1564903969, rs1262020902, rs1562831765, rs962082210, rs748264993, rs1004492719, rs1261058897, rs771794639, rs761370420, rs768922690, rs1588475891, rs745404241, rs775305020, rs770585183, rs1313340299, rs374586230, rs1588495489, rs1588496214, rs1588508532, rs1312396424, rs1482630982, rs1846142146, rs549085827, rs1488840592 |
2246255, 10097149, 28111830, 6763345, 23246278, 19006241, 27604308, 16475226, 8197477, 11083500, 28111830, 16475226, 10097149, 6763345, 23246278, 11083500, 19006241, 8197477, 2246255, 22106832, 26206375, 23246278, 24889030, 18925679, 11941481, 22473243, 8792870, 19006241, 15266621, 8197477, 7977368, 23099195, 24765495, 16475226, 2246255, 28111830, 23611581, 11083500, 12815590, 14680976, 27287393, 15863597, 26117549, 22768672, 9090528, 6763345, 24508627, 21227727, 25433810, 23094117, 15334737, 11571557, 7557970, 16124451, 25537548, 1943692, 2358466, 10097149, 25047749, 25179242, 11708871, 10987146, 23780642, 22494545, 23430935, 20005624, 19358837, 21483992, 18473344, 11738042, 21244552, 24713661 |
Developmental delay |
Global developmental delay |
rs28941770, rs199469464, rs281865469, rs143747297, rs398123009, rs587777428, rs786205133, rs606231459, rs797044854, rs797045027, rs864309504, rs878853160, rs886039902, rs886042046, rs886041291, rs886041382, rs1057518991, rs1057518699, rs753254213, rs748294403, rs762552974, rs1135401795, rs1553121073, rs1553122926, rs1364690005, rs1554086554, rs1554210415, rs1554168326, rs1554776342, rs1553873247, rs1567860112, rs779009256, rs1557447255, rs1564568350, rs780011005, rs1597464953, rs1200336864, rs1569513017, rs1587459606, rs1570332505, rs748888652, rs1575155995, rs2087029320, rs1589669105, rs1601769604, rs1184981709, rs749201074 |
|
Mental retardation |
Intellectual Disability |
rs5742905, rs267607136, rs267607137, rs2131714307, rs267607038, rs267607042, rs80338685, rs137853127, rs80338815, rs28940893, rs387906309, rs121908096, rs121908099, rs587784365, rs121918315, rs121918316, rs397515320, rs121434489, rs1585215916, rs267607233, rs267606752, rs137852214, rs606231193, rs132630297, rs80338758, rs137852815, rs122455132, rs28935171, rs122453113, rs122445108, rs28934904, rs28934908, rs28935468, rs61748421, rs121918624, rs202060209, rs80338708, rs113994198, rs199422192, rs387906635, rs1554770064, rs1057519611, rs1060499526, rs387906636, rs1057519612, rs281875189, rs281875322, rs387906799, rs387906804, rs875989800, rs797045262, rs387906845, rs387906846, rs876657378, rs281875227, rs281875228, rs281875229, rs281875230, rs387906861, rs370667926, rs387906932, rs387906943, rs1557612719, rs387907190, rs387907191, rs2126499522, rs587776908, rs1560982564, rs80359505, rs398123009, rs587776929, rs587776930, rs397514555, rs398122824, rs398122825, rs397514556, rs2147483647, rs587776937, rs397514627, rs397514655, rs397514656, rs730882192, rs1587520018, rs1581995953, rs1554121970, rs1581987445, rs397514670, rs376395543, rs137854128, rs397509411, rs397509412, rs397514741, rs398122394, rs879255516, rs397518483, rs398122406, rs398122412, rs398123561, rs200667343, rs587777162, rs587777202, rs62507350, rs587777219, rs587777225, rs587777226, rs587779750, rs587777326, rs587777334, rs281875332, rs587780470, rs587780474, rs587780486, rs587777378, rs587777406, rs587777408, rs587777409, rs587777411, rs587777522, rs527236034, rs527236035, rs267608571, rs267608382, rs267608597, rs61753979, rs61751444, rs267608493, rs587777644, rs587777645, rs587777646, rs587777703, rs587779388, rs606231266, rs606231267, rs672601340, rs606231268, rs672601341, rs606231269, rs672601342, rs606231270, rs606231271, rs606231272, rs606231273, rs587784566, rs587784092, rs587783749, rs587783747, rs587783640, rs587783483, rs606231456, rs606231457, rs606231458, rs606231459, rs672601370, rs672601369, rs672601371, rs672601367, rs672601366, rs672601365, rs672601364, rs672601363, rs672601362, rs672601376, rs672601377, rs672601378, rs724159949, rs724159950, rs724159948, rs724159956, rs724159953, rs727502860, rs727502861, rs730882197, rs749995448, rs786205143, rs794726770, rs1135401808, rs786205583, rs786205595, rs786205859, rs794727792, rs794727928, rs794729221, rs797044519, rs797044523, rs797044521, rs797044524, rs797044526, rs797044522, rs797044520, rs794727642, rs796052719, rs781746113, rs796052510, rs796052733, rs796052724, rs796052728, rs796052676, rs796053353, rs796053366, rs796053368, rs1555103986, rs1555110818, rs796052571, rs1555110843, rs796052626, rs796052618, rs796053290, rs796052217, rs672601368, rs797045164, rs797044961, rs797044962, rs200070245, rs797044963, rs869320675, rs869320676, rs797045012, rs752746786, rs797044885, rs797044925, rs797044854, rs797044849, rs797044930, rs797044901, rs797044918, rs797044884, rs797045177, rs797045178, rs797045050, rs797045036, rs797045053, rs797045047, rs797045037, rs797045042, rs797045041, rs879255261, rs782397980, rs797045263, rs797045264, rs797045655, rs797045586, rs545185248, rs797046031, rs797046028, rs797046029, rs797046030, rs797045249, rs797045529, rs797045952, rs797045984, rs797045540, rs797045539, rs797045989, rs863224930, rs869025202, rs863225264, rs863225077, rs876661308, rs869025222, rs864309560, rs758252808, rs745756308, rs869025286, rs869025287, rs869025578, rs143038880, rs869025579, rs869025580, rs869025581, rs869312704, rs869312674, rs869312677, rs869312689, rs869312693, rs869312698, rs869312708, rs869312711, rs869312826, rs869312825, rs869312824, rs869312823, rs758432471, rs869312821, rs761993070, rs869312844, rs869312842, rs869312843, rs869312841, rs869312847, rs869320632, rs869312955, rs773432002, rs869320713, rs869320772, rs869320773, rs879255270, rs875989848, rs875989849, rs1716457622, rs2108414289, rs878854401, rs875989786, rs1085307109, rs1085307108, rs876657679, rs876661167, rs876661076, rs876661055, rs876661219, rs876661064, rs876661151, rs876661041, rs200440467, rs876661295, rs878853045, rs878853143, rs878853142, rs878853149, rs1555910048, rs878853152, rs878853146, rs878853145, rs878853141, rs878853151, rs878853144, rs878853148, rs878853147, rs878853251, rs878853269, rs879253762, rs886037841, rs879253888, rs879253931, rs879254016, rs879255618, rs879255619, rs879255620, rs886037847, rs879255621, rs886039332, rs746177928, rs886039520, rs886041003, rs886041058, rs750035706, rs886041059, rs886041060, rs886041061, rs886041090, rs886041088, rs886041089, rs886041095, rs886041097, rs886041989, rs886041944, rs886041692, rs886041593, rs886041687, rs886041207, rs886041309, rs886041239, rs886041448, rs138336847, rs149644940, rs886041295, rs886041521, rs886041125, rs886042041, rs886041238, rs886041469, rs886041197, rs886041291, rs886041658, rs886041705, rs886041876, rs139716296, rs1057516030, rs1057517408, rs749655461, rs141179774, rs370916968, rs1057517676, rs1057517933, rs1057517708, rs1057518352, rs1057518183, rs1057518474, rs1057518204, rs1057517825, rs1057518796, rs1057518961, rs1057518772, rs1057518988, rs1057519004, rs1057518700, rs772450541, rs371310428, rs1057519019, rs1057519491, rs1057519546, rs1057519560, rs1057519565, rs1057519400, rs1057519402, rs1057519405, rs1057519593, rs1057519594, rs1057519628, rs1556912828, rs1060505029, rs1060505030, rs147001633, rs1057519947, rs1057519617, rs1057524832, rs774592932, rs797045045, rs1039571136, rs1555910821, rs1060499626, rs1060499655, rs1554770185, rs1060499936, rs1060501153, rs1060501151, rs1064792984, rs1060503378, rs1060503386, rs1060503383, rs1060500046, rs1064792999, rs1060505033, rs1064796564, rs1064797002, rs1064793161, rs150802299, rs1064796830, rs1064794996, rs1064795444, rs1064796034, rs1064796403, rs1064794979, rs1064796765, rs1064793539, rs760933323, rs1064793546, rs1064796406, rs1064796367, rs780441716, rs1064794894, rs1064796023, rs1064797355, rs1085307484, rs1064794935, rs1085307547, rs1131690804, rs757511770, rs1131691875, rs1131691979, rs398122823, rs1131691866, rs1131692159, rs1131692228, rs1131692154, rs113331868, rs1554121872, rs1554121875, rs926027867, rs1554122123, rs1554122129, rs1287121256, rs1554122526, rs1554123982, rs1554385102, rs1554385111, rs1554385305, rs1554386687, rs1554389088, rs1554402092, rs1554434435, rs1135401778, rs1135401760, rs1135401770, rs1135401771, rs1135401768, rs1135401779, rs1135401805, rs1135401797, rs1135401799, rs1135401816, rs1135401823, rs1135401824, rs1555769968, rs1135401825, rs1135401955, rs1135401956, rs1135401957, rs1135401958, rs1554129040, rs1554150543, rs1553188463, rs1553146165, rs1485978447, rs1361547443, rs750079325, rs369692236, rs1554231836, rs749188610, rs1554122735, rs1554689877, rs1174482090, rs781053477, rs1554623112, rs1555409836, rs1555411305, rs770014321, rs1555984461, rs1555990958, rs762292772, rs1554944271, rs1057524157, rs1485749468, rs1555984343, rs1293450628, rs373584239, rs1553722309, rs1553738686, rs1376334317, rs1553722294, rs1553283831, rs1554120589, rs1555985554, rs1555877287, rs1555411378, rs750922282, rs1553264873, rs1554263326, rs1554264268, rs1554263626, rs1554263625, rs766614772, rs1553620494, rs1555050158, rs1555050165, rs1555050171, rs1555050174, rs765556214, rs1402086660, rs1554645052, rs1555661648, rs1293246328, rs749494995, rs775592405, rs1553265189, rs1553242856, rs1553247374, rs1553241570, rs1553997065, rs1553998565, rs1380822792, rs1555028154, rs1555023232, rs1553194155, rs1553130904, rs1553152590, rs1553567864, rs1553638614, rs120074160, rs1554486894, rs1554767754, rs1554843977, rs1555443581, rs1555443600, rs1555439545, rs1555525088, rs770680174, rs1555889130, rs373178770, rs1555985532, rs1553519853, rs781325598, rs1410587479, rs1553638086, rs150259543, rs1554093891, rs1554121228, rs1554120498, rs1554121189, rs1212517874, rs1554770628, rs1555979158, rs1554770054, rs771610568, rs1451230055, rs1554770624, rs1555906707, rs1555906768, rs1555906781, rs1555907620, rs1555907623, rs1555907626, rs1555907653, rs1555907864, rs1554094145, rs1554202698, rs1554200722, rs773327091, rs1555607621, rs1555604778, rs1555607159, rs1555607682, rs1553364018, rs1553324416, rs1555411394, rs1554102556, rs1554122363, rs1555705966, rs1555103971, rs1555408401, rs1554461593, rs1554304254, rs1554120978, rs1047509819, rs1555982601, rs767774867, rs1554789246, rs1555111511, rs1555950676, rs1555954380, rs1555985649, rs1553194162, rs1553518509, rs1274633498, rs1554274371, rs1554122252, rs1554122458, rs1554122729, rs1554297905, rs1554776342, rs1554770046, rs1554770667, rs1554792556, rs1452715535, rs1555444885, rs1555534147, rs1427624649, rs1555611722, rs1555744282, rs1555706391, rs1178702025, rs1555984102, rs1554770589, rs1554121443, rs1559791842, rs1559824939, rs1555889127, rs1236702036, rs1553510280, rs1553511175, rs1553511226, rs1554150552, rs1554275163, rs1554201137, rs1553517991, rs1553518511, rs1553517984, rs1553518752, rs1554119814, rs1554122293, rs1554122341, rs1554122689, rs1554770243, rs1554770444, rs1557045250, rs959316981, rs1556270312, rs1553270640, rs978179634, rs1554093884, rs1491240980, rs1555943484, rs1554121453, rs1334099693, rs1554048616, rs1555660806, rs1555644480, rs1555651572, rs1567844992, rs1567855081, rs1567855669, rs1567855704, rs1567856045, rs1567856331, rs1567860075, rs1567860112, rs1567860640, rs1567860891, rs754919272, rs1567860919, rs1567861468, rs1567861489, rs1567861501, rs1567861894, rs1567863732, rs1567864750, rs1567877108, rs1567878511, rs758785463, rs1553808301, rs1553245038, rs1553789166, rs1553813646, rs1553631860, rs1554121265, rs1554770262, rs1555034768, rs1555984433, rs779009256, rs1553994814, rs1553996086, rs1553996072, rs1553270599, rs1553153291, rs760262127, rs1554119274, rs1554121878, rs1554387293, rs1554385203, rs757077698, rs750612085, rs1554776500, rs1564360978, rs1554776933, rs1554776938, rs1565278132, rs1567368243, rs1558478047, rs375695605, rs1558479778, rs1558501648, rs1565240833, rs114727354, rs1557591264, rs1557620758, rs1559099927, rs1561788984, rs369459721, rs1563831738, rs1562159088, rs1562159562, rs1562159599, rs1559094754, rs1559328283, rs755634856, rs1561784687, rs1554122296, rs1561789313, rs1562720119, rs1564363665, rs1561697465, rs1561785003, rs1561787845, rs1561789215, rs1554122305, rs1561784553, rs1561784560, rs1561787690, rs1554122888, rs749632782, rs1567139896, rs1569370887, rs1569371303, rs1564493599, rs1561875779, rs1569146542, rs1569146649, rs1275489527, rs1560115921, rs1468772495, rs749969789, rs1560108090, rs1569376809, rs1569355102, rs1560103306, rs1564365418, rs1559855453, rs1562928193, rs1558149913, rs1253072668, rs141976414, rs1558371790, rs1557898800, rs1567758622, rs1567844041, rs1567844114, rs1567920106, rs1567920209, rs138247472, rs1567974030, rs1567995650, rs1283838287, rs1568003569, rs1568006217, rs1568018905, rs1562505675, rs1561783309, rs1555980234, rs1559087186, rs1560966086, rs1560330387, rs769471341, rs1562493608, rs1562505335, rs1554121861, rs1554122200, rs1562957809, rs1568097623, rs1391600900, rs1568234874, rs1568235086, rs1555990955, rs1567870541, rs1557570794, rs1562869207, rs1571818248, rs1431778557, rs369691608, rs1595808957, rs1597665063, rs1597846084, rs1603401125, rs1603350606, rs1601946481, rs1601932069, rs1602880906, rs1602308324, rs1574554519, rs1573882268, rs1603198937, rs1558148010, rs1558498928, rs1569459580, rs1569380375, rs1560062082, rs1557889974, rs1558414255, rs756429763, rs781663444, rs1569016820, rs1569017025, rs1569017160, rs1557612048, rs1568504941, rs1581987022, rs1576983339, rs1599892470, rs1265340906, rs1602284689, rs1574949440, rs1576220938, rs1576280892, rs1576288424, rs1574459612, rs1574511051, rs1575654528, rs1577094794, rs1294683568, rs771819481, rs1580984895, rs1581338441, rs1580988138, rs1581980317, rs1581986872, rs1554121207, rs1581987268, rs1581987476, rs1581987885, rs763770519, rs1581991929, rs1581992099, rs1581992998, rs1581995453, rs1554122242, rs1581996778, rs1581997228, rs1588735247, rs1555980467, rs1555985742, rs1601319086, rs1601970168, rs1574451881, rs876661168, rs1576994053, rs1573589807, rs1581036396, rs1601267617, rs1572531830, rs1573483715, rs1590954686, rs1601315812, rs1573965358, rs1573972562, rs529087882, rs1570609440, rs1598940393, rs1575333081, rs1576028676, rs1596476657, rs1599375711, rs1603290366, rs1603060007, rs1603069440, rs1592939069, rs1591612223, rs2062994512, rs373701249, rs1600471396, rs1600501018, rs1600504088, rs1600514073, rs748436953, rs765723607, rs758170522, rs1561785045, rs1357591960, rs1591609136, rs1596891223, rs1579370234, rs2047850664, rs1579109565, rs1870202051, rs1574887674, rs778229060, rs1572531281, rs1570622663, rs1573501865, rs1576086299, rs1576164991, rs1574907198, rs1576656734, rs1554121438, rs1581995425, rs1581996813, rs1582001015, rs1588324025, rs1591371152, rs1590008294, rs1590956245, rs1590028691, rs1591606580, rs1591611001, rs1591612317, rs1591612370, rs763436882, rs997044541, rs1595897117, rs747706524, rs1579377990, rs1201878175, rs1894051550, rs1572531730, rs1579576029, rs1577017863, rs752545577, rs1582461267, rs1589460606, rs1588727276, rs1598620094, rs1599368323, rs1600082188, rs1601319352, rs1598226304, rs2076013475, rs2076017638, rs1600596180, rs1554121932, rs1680676671, rs1570607996, rs1382444181, rs1570640673, rs1574994308, rs1596667777, rs1602226289, rs1595629181, rs1595609005, rs1227643933, rs1572705473, rs1570621899, rs1722830922, rs1575094649, rs1417035592, rs1581997098, rs1589457762, rs1598211790, rs758726258, rs1601071971, rs863224922, rs1586692481, rs1586692548, rs1586692551, rs1580988074, rs1594129609, rs1588732344, rs1579368865, rs1586660389, rs1586660370, rs1586660338, rs1586657848, rs1586660381, rs1791701214, rs752676391, rs1680673822, rs758098717, rs1726676630, rs762288077, rs1759964009, rs1760905766, rs1761021165, rs1554121934, rs2055849544, rs1049773, rs587784300, rs1861628072, rs1761241410, rs1064797322, rs1948652423, rs2059194330, rs1777174302, rs2054280202, rs2081190512, rs772665884, rs1400164869, rs1861593395, rs1760897843, rs1761087122, rs1388355040, rs2068797192, rs1777175608, rs376898131 |
19006241 |
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Argininosuccinic acid synthetase deficiency disease |
Argininosuccinic Acid Synthetase Deficiency Disease, Partial |
|
|
Cirrhosis |
Cirrhosis |
rs119465999, rs144369314, rs8056684, rs112053857, rs75998507 |
|
Diabetic cardiomyopathy |
Diabetic Angiopathies, Microangiopathy, Diabetic |
|
25033204 |
|
|
|