LAMC2 (laminin subunit gamma 2)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
3918 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Laminin subunit gamma 2 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
LAMC2 |
SynonymsGene synonyms aliases
|
B2T, BM600, CSF, EBR2, EBR2A, JEB3A, JEB3B, LAMB2T, LAMNB2 |
ChromosomeChromosome number
|
1 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
1q25.3 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, n |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs80356683 |
C>T |
Pathogenic |
Coding sequence variant, stop gained |
rs118203899 |
C>G,T |
Likely-pathogenic |
Stop gained, synonymous variant, coding sequence variant |
rs118203900 |
C>A |
Pathogenic |
Stop gained, coding sequence variant |
rs118203901 |
C>T |
Likely-pathogenic, pathogenic |
Stop gained, coding sequence variant |
rs141812464 |
G>C |
Conflicting-interpretations-of-pathogenicity |
Coding sequence variant, synonymous variant |
rs146325169 |
G>A |
Uncertain-significance, conflicting-interpretations-of-pathogenicity |
Missense variant, coding sequence variant |
rs147889360 |
A>C,G |
Uncertain-significance, conflicting-interpretations-of-pathogenicity |
Missense variant, coding sequence variant |
rs149195906 |
G>A |
Likely-pathogenic |
Splice acceptor variant |
rs151190720 |
C>G,T |
Likely-pathogenic |
Missense variant, genic downstream transcript variant, stop gained, coding sequence variant |
rs201307156 |
C>T |
Likely-pathogenic |
Coding sequence variant, stop gained, genic downstream transcript variant |
rs745512079 |
G>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs753268823 |
C>T |
Likely-pathogenic |
Coding sequence variant, stop gained |
rs757617349 |
C>A,T |
Likely-pathogenic |
Stop gained, coding sequence variant, missense variant |
rs759509443 |
G>A |
Likely-pathogenic |
Splice donor variant |
rs771613805 |
A>G |
Likely-pathogenic |
Splice acceptor variant |
rs774080932 |
G>A,C |
Likely-pathogenic |
Splice acceptor variant |
rs776142807 |
A>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant, 3 prime UTR variant |
rs778012079 |
TTTCAGA>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs886045625 |
A>G |
Uncertain-significance, likely-pathogenic |
Initiator codon variant, missense variant |
rs1043996591 |
G>T |
Likely-pathogenic |
Splice donor variant |
rs1057516218 |
GG>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1057516383 |
CTGC>- |
Likely-pathogenic |
3 prime UTR variant, coding sequence variant, frameshift variant |
rs1057516410 |
G>C |
Likely-pathogenic |
Splice donor variant |
rs1057516444 |
->AA |
Likely-pathogenic |
Stop gained, coding sequence variant |
rs1057516473 |
G>- |
Likely-pathogenic |
Genic downstream transcript variant, coding sequence variant, frameshift variant |
rs1057516487 |
G>A |
Likely-pathogenic |
Splice acceptor variant |
rs1057516569 |
AG>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1057516727 |
CA>- |
Likely-pathogenic |
Genic downstream transcript variant, coding sequence variant, frameshift variant |
rs1057516806 |
GACA>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1057516935 |
TC>- |
Likely-pathogenic |
Genic downstream transcript variant, coding sequence variant, frameshift variant |
rs1057517159 |
->G |
Likely-pathogenic |
Genic downstream transcript variant, coding sequence variant, frameshift variant |
rs1057517353 |
->ATGGA |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1217053724 |
C>T |
Likely-pathogenic, pathogenic |
Genic downstream transcript variant, coding sequence variant, stop gained |
rs1479808203 |
G>C,T |
Likely-pathogenic |
Initiator codon variant, missense variant |
rs1553262199 |
T>C |
Pathogenic |
Initiator codon variant, missense variant |
rs1553264644 |
->T |
Likely-pathogenic |
Coding sequence variant, stop gained |
rs1553265770 |
A>C |
Likely-pathogenic |
Splice acceptor variant |
rs1553265794 |
T>A |
Likely-pathogenic |
Splice donor variant |
rs1553265902 |
A>G |
Likely-pathogenic |
Splice acceptor variant |
rs1553266052 |
G>A |
Likely-pathogenic |
Splice donor variant |
rs1553266260 |
A>T |
Likely-pathogenic |
Splice acceptor variant |
rs1553266433 |
A>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
rs1553266537 |
G>- |
Likely-pathogenic |
Splice donor variant, coding sequence variant |
rs1553266671 |
T>C,G |
Likely-pathogenic |
Splice donor variant |
rs1553266871 |
GC>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
rs1553267007 |
G>A |
Likely-pathogenic |
Splice donor variant |
rs1553267060 |
T>G |
Likely-pathogenic |
Splice donor variant |
rs1553267345 |
->TAGCCCGG |
Likely-pathogenic |
Frameshift variant, genic downstream transcript variant, downstream transcript variant, coding sequence variant |
rs1553267356 |
G>C |
Likely-pathogenic |
Splice donor variant, downstream transcript variant, genic downstream transcript variant |
rs1553267499 |
G>C |
Likely-pathogenic |
Genic downstream transcript variant, splice acceptor variant |
rs1553267554 |
A>G |
Likely-pathogenic |
Genic downstream transcript variant, splice acceptor variant |
rs1553267638 |
G>C |
Likely-pathogenic |
Splice donor variant, genic downstream transcript variant |
rs1553267679 |
CA>- |
Likely-pathogenic |
Genic downstream transcript variant, frameshift variant, coding sequence variant |
rs1553267870 |
A>G |
Likely-pathogenic |
Genic downstream transcript variant, splice acceptor variant |
rs1553267882 |
GAAGCTTTCCCGAGCCAAGA>- |
Likely-pathogenic |
Genic downstream transcript variant, frameshift variant, coding sequence variant |
rs1553267885 |
A>- |
Likely-pathogenic |
Genic downstream transcript variant, frameshift variant, coding sequence variant |
rs1558088792 |
G>A |
Pathogenic |
Splice acceptor variant |
rs1558092158 |
G>T |
Likely-pathogenic |
Splice donor variant |
rs1558092501 |
G>A |
Pathogenic |
Splice acceptor variant |
rs1558095794 |
CAGAACC>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1571530029 |
TCCCTGTCATA>AACCGC |
Pathogenic |
Coding sequence variant, stop gained, inframe indel |
rs1571535301 |
C>T |
Pathogenic |
Coding sequence variant, stop gained |
rs1571538391 |
AGCCCGGACGGTGCTGTGGT>G |
Likely-pathogenic |
Frameshift variant, coding sequence variant, downstream transcript variant, genic downstream transcript variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
miRTarBase ID |
miRNA |
Experiments |
Reference |
MIRT002944 |
hsa-miR-199b-5p |
Luciferase reporter assay |
15131085 |
MIRT019261 |
hsa-miR-148b-3p |
Microarray |
17612493 |
MIRT025668 |
hsa-miR-7-5p |
Microarray |
19073608 |
MIRT437368 |
hsa-miR-29a-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
24091622 |
MIRT437368 |
hsa-miR-29a-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
24091622 |
MIRT437368 |
hsa-miR-29a-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
24091622 |
MIRT437368 |
hsa-miR-29a-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
24091622 |
MIRT437369 |
hsa-miR-29b-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
24091622 |
MIRT437369 |
hsa-miR-29b-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
24091622 |
MIRT437369 |
hsa-miR-29b-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
24091622 |
MIRT437369 |
hsa-miR-29b-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
24091622 |
MIRT437370 |
hsa-miR-29c-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
24091622 |
MIRT437370 |
hsa-miR-29c-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
24091622 |
MIRT437370 |
hsa-miR-29c-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
24091622 |
MIRT437370 |
hsa-miR-29c-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
24091622 |
MIRT438307 |
hsa-miR-146a-5p |
In situ hybridization, Weastern blot, Luciferase reporter assay/qRT-PCR |
25214035 |
MIRT438307 |
hsa-miR-146a-5p |
In situ hybridization, Weastern blot, Luciferase reporter assay/qRT-PCR |
25214035 |
MIRT438307 |
hsa-miR-146a-5p |
In situ hybridization, Weastern blot, Luciferase reporter assay/qRT-PCR |
25214035 |
MIRT438307 |
hsa-miR-146a-5p |
In situ hybridization, Weastern blot, Luciferase reporter assay/qRT-PCR |
25214035 |
MIRT732502 |
hsa-miR-5580-3p |
Microarray |
32597160 |
MIRT1103407 |
hsa-miR-1193 |
CLIP-seq |
|
MIRT1103408 |
hsa-miR-1224-3p |
CLIP-seq |
|
MIRT1103409 |
hsa-miR-1226 |
CLIP-seq |
|
MIRT1103410 |
hsa-miR-1260 |
CLIP-seq |
|
MIRT1103411 |
hsa-miR-1260b |
CLIP-seq |
|
MIRT1103412 |
hsa-miR-128 |
CLIP-seq |
|
MIRT1103413 |
hsa-miR-1280 |
CLIP-seq |
|
MIRT1103414 |
hsa-miR-134 |
CLIP-seq |
|
MIRT1103415 |
hsa-miR-1827 |
CLIP-seq |
|
MIRT1103416 |
hsa-miR-192 |
CLIP-seq |
|
MIRT1103417 |
hsa-miR-193a-3p |
CLIP-seq |
|
MIRT1103418 |
hsa-miR-193b |
CLIP-seq |
|
MIRT1103419 |
hsa-miR-215 |
CLIP-seq |
|
MIRT1103420 |
hsa-miR-2467-3p |
CLIP-seq |
|
MIRT1103421 |
hsa-miR-29a |
CLIP-seq |
|
MIRT1103422 |
hsa-miR-29b |
CLIP-seq |
|
MIRT1103423 |
hsa-miR-29c |
CLIP-seq |
|
MIRT1103424 |
hsa-miR-3065-3p |
CLIP-seq |
|
MIRT1103425 |
hsa-miR-3118 |
CLIP-seq |
|
MIRT1103426 |
hsa-miR-3134 |
CLIP-seq |
|
MIRT1103427 |
hsa-miR-3164 |
CLIP-seq |
|
MIRT1103428 |
hsa-miR-3202 |
CLIP-seq |
|
MIRT1103429 |
hsa-miR-331-3p |
CLIP-seq |
|
MIRT1103430 |
hsa-miR-338-5p |
CLIP-seq |
|
MIRT1103431 |
hsa-miR-3661 |
CLIP-seq |
|
MIRT1103432 |
hsa-miR-3678-3p |
CLIP-seq |
|
MIRT1103433 |
hsa-miR-3688-3p |
CLIP-seq |
|
MIRT1103434 |
hsa-miR-3714 |
CLIP-seq |
|
MIRT1103435 |
hsa-miR-3978 |
CLIP-seq |
|
MIRT1103436 |
hsa-miR-4302 |
CLIP-seq |
|
MIRT1103437 |
hsa-miR-4327 |
CLIP-seq |
|
MIRT1103438 |
hsa-miR-4426 |
CLIP-seq |
|
MIRT1103439 |
hsa-miR-4517 |
CLIP-seq |
|
MIRT1103440 |
hsa-miR-451b |
CLIP-seq |
|
MIRT1103441 |
hsa-miR-4533 |
CLIP-seq |
|
MIRT1103442 |
hsa-miR-4647 |
CLIP-seq |
|
MIRT1103443 |
hsa-miR-4662b |
CLIP-seq |
|
MIRT1103444 |
hsa-miR-4701-5p |
CLIP-seq |
|
MIRT1103445 |
hsa-miR-4708-3p |
CLIP-seq |
|
MIRT1103446 |
hsa-miR-539 |
CLIP-seq |
|
MIRT1103447 |
hsa-miR-545 |
CLIP-seq |
|
MIRT1103448 |
hsa-miR-548b-3p |
CLIP-seq |
|
MIRT1103449 |
hsa-miR-580 |
CLIP-seq |
|
MIRT1103450 |
hsa-miR-588 |
CLIP-seq |
|
MIRT1103451 |
hsa-miR-631 |
CLIP-seq |
|
MIRT1103452 |
hsa-miR-660 |
CLIP-seq |
|
MIRT1103453 |
hsa-miR-767-5p |
CLIP-seq |
|
MIRT1103454 |
hsa-miR-892b |
CLIP-seq |
|
MIRT1103455 |
hsa-miR-129-5p |
CLIP-seq |
|
MIRT1103456 |
hsa-miR-3194-3p |
CLIP-seq |
|
MIRT1103457 |
hsa-miR-3672 |
CLIP-seq |
|
MIRT1103458 |
hsa-miR-431 |
CLIP-seq |
|
MIRT1103459 |
hsa-miR-4438 |
CLIP-seq |
|
MIRT1103460 |
hsa-miR-5095 |
CLIP-seq |
|
MIRT1103461 |
hsa-miR-640 |
CLIP-seq |
|
MIRT2028260 |
hsa-miR-1228 |
CLIP-seq |
|
MIRT2028261 |
hsa-miR-1229 |
CLIP-seq |
|
MIRT2028262 |
hsa-miR-1825 |
CLIP-seq |
|
MIRT2028263 |
hsa-miR-3130-5p |
CLIP-seq |
|
MIRT2028264 |
hsa-miR-342-3p |
CLIP-seq |
|
MIRT2028265 |
hsa-miR-4482 |
CLIP-seq |
|
MIRT2028266 |
hsa-miR-4686 |
CLIP-seq |
|
MIRT2028267 |
hsa-miR-4772-5p |
CLIP-seq |
|
MIRT2028268 |
hsa-miR-888 |
CLIP-seq |
|
MIRT2259398 |
hsa-miR-1208 |
CLIP-seq |
|
MIRT2259399 |
hsa-miR-1281 |
CLIP-seq |
|
MIRT2259400 |
hsa-miR-1343 |
CLIP-seq |
|
MIRT2259401 |
hsa-miR-185 |
CLIP-seq |
|
MIRT2259402 |
hsa-miR-2278 |
CLIP-seq |
|
MIRT2259403 |
hsa-miR-2355-5p |
CLIP-seq |
|
MIRT2259404 |
hsa-miR-24 |
CLIP-seq |
|
MIRT2259405 |
hsa-miR-3135b |
CLIP-seq |
|
MIRT2259406 |
hsa-miR-3150a-5p |
CLIP-seq |
|
MIRT2259407 |
hsa-miR-3150b-5p |
CLIP-seq |
|
MIRT2259408 |
hsa-miR-3652 |
CLIP-seq |
|
MIRT2259409 |
hsa-miR-4284 |
CLIP-seq |
|
MIRT2259410 |
hsa-miR-4306 |
CLIP-seq |
|
MIRT2259411 |
hsa-miR-4430 |
CLIP-seq |
|
MIRT2259412 |
hsa-miR-4519 |
CLIP-seq |
|
MIRT2259413 |
hsa-miR-4644 |
CLIP-seq |
|
MIRT2259414 |
hsa-miR-498 |
CLIP-seq |
|
MIRT2028268 |
hsa-miR-888 |
CLIP-seq |
|
MIRT2559748 |
hsa-miR-4267 |
CLIP-seq |
|
MIRT2559749 |
hsa-miR-4735-5p |
CLIP-seq |
|
MIRT2559750 |
hsa-miR-4775 |
CLIP-seq |
|
MIRT2559751 |
hsa-miR-590-3p |
CLIP-seq |
|
MIRT2683738 |
hsa-miR-1256 |
CLIP-seq |
|
MIRT2683739 |
hsa-miR-3688-5p |
CLIP-seq |
|
MIRT2683740 |
hsa-miR-4652-3p |
CLIP-seq |
|
MIRT2683741 |
hsa-miR-4659a-5p |
CLIP-seq |
|
MIRT2683742 |
hsa-miR-4659b-5p |
CLIP-seq |
|
MIRT2683743 |
hsa-miR-4776-3p |
CLIP-seq |
|
MIRT2683744 |
hsa-miR-579 |
CLIP-seq |
|
|
Transcription factors
|
Transcription factor |
Regulation |
Reference |
ZEB1 |
Unknown |
20729552 |
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
Q13753 |
Protein name |
Laminin subunit gamma-2 (Cell-scattering factor 140 kDa subunit) (CSF 140 kDa subunit) (Epiligrin subunit gamma) (Kalinin subunit gamma) (Kalinin/nicein/epiligrin 100 kDa subunit) (Ladsin 140 kDa subunit) (Laminin B2t chain) (Laminin-5 subunit gamma) (Lar |
Protein function |
Binding to cells via a high affinity receptor, laminin is thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. Ladsin exerts c |
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF00053 |
Laminin_EGF |
28 → 81 |
Laminin EGF domain |
Domain |
PF00053 |
Laminin_EGF |
84 → 130 |
Laminin EGF domain |
Domain |
PF00053 |
Laminin_EGF |
139 → 184 |
Laminin EGF domain |
Domain |
PF00052 |
Laminin_B |
250 → 380 |
Laminin B (Domain IV) |
Family |
PF00053 |
Laminin_EGF |
376 → 413 |
Laminin EGF domain |
Domain |
PF00053 |
Laminin_EGF |
462 → 514 |
Laminin EGF domain |
Domain |
PF00053 |
Laminin_EGF |
517 → 570 |
Laminin EGF domain |
Domain |
PF00053 |
Laminin_EGF |
573 → 617 |
Laminin EGF domain |
Domain |
|
Sequence |
|
Sequence length |
1193 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Amelogenesis imperfecta |
Amelogenesis Imperfecta |
rs267607178, rs143816093, rs606231351, rs137854435, rs137854440, rs137854441, rs137854444, rs587776587, rs121908109, rs587776588, rs140213840, rs104894704, rs387906487, rs387906488, rs387906489, rs104894733, rs104894734, rs104894736, rs387906490, rs387906491, rs104894737, rs104894738, rs144411158, rs587776911, rs587776912, rs587776913, rs587776914, rs387907215, rs866941536, rs1560562738, rs1560562630, rs146645381, rs1560558455, rs587777515, rs587777516, rs587777530, rs139620139, rs587777531, rs587777535, rs587777536, rs587777537, rs606231462, rs1553275034, rs869320671, rs786201004, rs140015315, rs730882118, rs730880297, rs730880298, rs786204825, rs786204826, rs1555409827, rs1057517671, rs1057517672, rs556734208, rs146238585, rs202073531, rs1057519277, rs767907487, rs779823931, rs1060499539, rs1085307111, rs546603773, rs1553275070, rs1553275195, rs752102959, rs1554623490, rs1553888384, rs770804941, rs1553887511, rs557128345, rs1568724130, rs199527325, rs1603038146, rs773117913, rs1560973571, rs1560782372, rs1560980659, rs1560973467, rs772929908, rs762816338, rs1565222166, rs1595312054, rs1866200282, rs2086254952 |
26956061 |
Anemia |
Anemia |
rs118204044, rs118204045, rs118204046, rs121918330, rs869320719, rs869312029, rs121918332, rs869320724, rs767094129, rs786205058, rs786205059, rs137853119, rs137853120, rs137853121, rs1384933966, rs137853122, rs137853123, rs786205060, rs267607121, rs121908584, rs80338697, rs80338699, rs120074166, rs120074167, rs1050828, rs74575103, rs137852314, rs5030868, rs137852316, rs137852317, rs137852318, rs137852319, rs137852320, rs137852321, rs137852322, rs137852323, rs137852324, rs72554665, rs387906468, rs5030872, rs137852326, rs137852333, rs137852327, rs137852328, rs137852329, rs137852330, rs137852331, rs137852332, rs137852334, rs137852335, rs137852336, rs137852339, rs76645461, rs137852340, rs137852341, rs78478128, rs137852343, rs137852344, rs137852345, rs587776730, rs137852346, rs137852347, rs137852349, rs2070404412, rs2070350038, rs2070350009, rs137852303, rs137852304, rs33946267, rs34378160, rs33933298, rs11549407, rs35724775, rs34598529, rs41469945, rs267607201, rs80338694, rs80338696, rs387907018, rs398123546, rs78365220, rs587777100, rs587777101, rs483352840, rs869312752, rs765487627, rs1557229599, rs1557230040, rs1555524842, rs782090947, rs1358275550, rs1557229736, rs1557230573, rs1556323334, rs1233124208, rs1293528130, rs146864395, rs1595503440, rs1603411214, rs137852325, rs1575247302, rs1603411177, rs1336651679, rs782322505 |
|
Anonychia |
ANONYCHIA |
rs74315420, rs74315421, rs74315422, rs74315423, rs387907026, rs387907027, rs387907028, rs780261665, rs775644973, rs370554150 |
|
Aplasia cutis congenita |
Aplasia Cutis Congenita |
rs587777706 |
|
Cardiomyopathy |
Cardiomyopathy, Dilated |
rs267607003, rs267607002, rs267607004, rs63750743, rs121908333, rs121908334, rs104894655, rs121434420, rs121434421, rs193922674, rs111517471, rs121908987, rs193922384, rs121909374, rs121909377, rs2856655, rs587776700, rs397514444, rs387906397, rs137854607, rs28935197, rs199473684, rs121964858, rs74315379, rs74315380, rs104894724, rs104894727, rs104894728, rs104894729, rs104894730, rs121917760, rs267607125, rs104894503, rs267607155, rs267607156, rs121918597, rs121918600, rs28933979, rs121918070, rs76992529, rs111033559, rs111033560, rs104894368, rs104894369, rs104894370, rs121913624, rs3218713, rs121913625, rs121913626, rs121913627, rs121913628, rs121913629, rs121913630, rs121913631, rs121913632, rs3218714, rs121913637, rs121913638, rs121913641, rs121913642, rs121913651, rs267606911, rs267606908, rs730880850, rs61046466, rs57520892, rs28933091, rs28933092, rs28933093, rs121913008, rs121913003, rs121912996, rs121912997, rs193922680, rs387906875, rs199474703, rs199476315, rs199476316, rs199476317, rs199476321, rs199476311, rs193922683, rs193922668, rs386134243, rs267607578, rs36211723, rs193922390, rs193922672, rs193922697, rs387907267, rs45546039, rs387907218, rs397515870, rs397515893, rs397515894, rs397515903, rs397515905, rs375882485, rs397515907, rs397515912, rs397515916, rs397515925, rs397515926, rs397515934, rs397515937, rs397515943, rs397515944, rs397515947, rs397515954, rs112738974, rs111729952, rs397515960, rs397515963, rs397515973, rs397515974, rs397515977, rs376395543, rs397515979, rs397515982, rs397515990, rs397515991, rs397515992, rs397516005, rs113358486, rs397516006, rs397516007, rs397516008, rs373746463, rs397516019, rs397516023, rs397516029, rs397516031, rs397516037, rs397516040, rs397516042, rs397516044, rs397516049, rs397516057, rs397516059, rs397516068, rs397516070, rs397516072, rs397516073, rs397516074, rs397516076, rs397516077, rs397516080, rs397516082, rs397516083, rs397516088, rs397516089, rs397516103, rs397516123, rs397516127, rs371898076, rs397516132, rs397516142, rs3218716, rs397516154, rs397516161, rs397516165, rs397516170, rs397516178, rs397516179, rs397516187, rs397516201, rs397516202, rs145213771, rs397516207, rs397516209, rs397516212, rs397516248, rs397516252, rs397516254, rs397516258, rs397516260, rs45516091, rs397516264, rs397516269, rs397516347, rs397516349, rs397516352, rs397516353, rs397516355, rs397516356, rs397516357, rs397516364, rs397516370, rs397516371, rs397516373, rs397516386, rs397516406, rs397516454, rs397516456, rs397516461, rs397516463, rs397516464, rs45525839, rs397516471, rs45578238, rs111377893, rs397516607, rs62636495, rs397516784, rs397516881, rs397516913, rs397516915, rs397516927, rs397516940, rs397516943, rs397516945, rs397516955, rs397516956, rs397516973, rs397516986, rs397516989, rs372827156, rs397516992, rs397516993, rs397516994, rs397516997, rs397517003, rs397517008, rs397517010, rs397517012, rs397517021, rs397517065, rs397517547, rs397517576, rs397517580, rs397517584, rs397517586, rs397517587, rs397517589, rs397517601, rs397517620, rs397517624, rs397517626, rs397517628, rs72646831, rs397517633, rs397517643, rs72646846, rs397517664, rs397517679, rs397517689, rs397517695, rs397517696, rs397517698, rs397517721, rs397517735, rs397517741, rs397517749, rs397517750, rs397517758, rs397517776, rs397517787, rs397517830, rs397517887, rs397517888, rs397517889, rs58013325, rs397517895, rs56984562, rs267607646, rs58917027, rs267607594, rs397517904, rs61195471, rs60682848, rs267607573, rs397517908, rs58978449, rs397517909, rs267607593, rs397517911, rs56816490, rs397517915, rs267607554, rs397514742, rs886041395, rs397515482, rs267607490, rs58999456, rs267607555, rs61672878, rs267607618, rs267607577, rs57730570, rs267607582, rs267607581, rs61444459, rs59270054, rs61661343, rs267607570, rs59026483, rs267607571, rs59332535, rs199473161, rs398123262, rs869320740, rs606231324, rs587782927, rs201754030, rs58389804, rs587782958, rs587782961, rs587782962, rs587782986, rs138049878, rs376897125, rs368765949, rs111569862, rs727504247, rs727503537, rs727504535, rs727504550, rs727504679, rs727503546, rs730880365, rs727504646, rs727505014, rs727505288, rs727503557, rs727503559, rs730880343, rs727503615, rs727504825, rs727503565, rs727504655, rs727505352, rs727504466, rs727504531, rs727503567, rs371678190, rs727503586, rs727505319, rs727503547, rs727505076, rs727505224, rs727503552, rs727504856, rs727504782, rs727504660, rs557312035, rs727505284, rs727504851, rs727504589, rs727504499, rs727504843, rs727504452, rs727503697, rs150974575, rs727504498, rs727503598, rs727503602, rs727503607, rs727504801, rs727504738, rs727505115, rs727505283, rs727505109, rs727504271, rs727504321, rs727504289, rs727503172, rs727503180, rs727503182, rs727504265, rs727504334, rs727503192, rs397515932, rs727504287, rs200411226, rs727503204, rs727504269, rs367947846, rs730880335, rs727502897, rs727503166, rs111683277, rs727503195, rs727503203, rs727503212, rs727503738, rs727504381, rs727504356, rs727503261, rs727504238, rs148808089, rs45544633, rs727503246, rs397516171, rs727503253, rs202141173, rs727504310, rs727503258, rs727503260, rs727504320, rs727504240, rs727503263, rs727503269, rs727503278, rs727504432, rs727504243, rs727504285, rs727503499, rs727503504, rs727504242, rs727504379, rs727504389, rs727504275, rs727504557, rs727502994, rs727504184, rs730880336, rs730880362, rs730880199, rs730880246, rs72648265, rs730880243, rs730880242, rs730880241, rs574660186, rs730880245, rs730880082, rs730880092, rs730880093, rs730880055, rs397515939, rs730881119, rs397516020, rs730880675, rs730880719, rs730880672, rs730880671, rs730880718, rs730880666, rs730880717, rs730880655, rs730880715, rs730880654, rs730880714, rs730880651, rs730880648, rs730880713, rs730880546, rs730880695, rs730880533, rs730880531, rs730880639, rs730880689, rs730880686, rs730880629, rs368121566, rs375607980, rs730880704, rs730880698, rs730880750, rs730880748, rs730880875, rs730880845, rs1565623093, rs786204339, rs786204336, rs786204392, rs786204388, rs786204950, rs786204951, rs794727381, rs760576804, rs112188483, rs794728597, rs794728606, rs794728593, rs59564495, rs190140598, rs794728826, rs794728803, rs794728106, rs149701627, rs1554108152, rs770873593, rs794728124, rs141026028, rs794728094, rs794729098, rs794729116, rs764817683, rs751288871, rs201405287, rs794729137, rs794729133, rs766209297, rs767987619, rs769220833, rs794729120, rs112240298, rs748382770, rs794729365, rs794729301, rs757451467, rs794729359, rs794729354, rs794729353, rs794729285, rs794729284, rs794729338, rs794729332, rs368452607, rs794729278, rs794729325, rs794729324, rs754866489, rs794729265, rs751502842, rs794729320, rs794729380, rs748313513, rs797046064, rs863225113, rs863225106, rs761507504, rs864622224, rs1057515421, rs751039219, rs869025555, rs869025546, rs869025554, rs869025559, rs869025545, rs869025558, rs869025557, rs200797552, rs869025550, rs869025549, rs869025544, rs869025552, rs869025548, rs869025556, rs770029258, rs869025523, rs869025398, rs869025399, rs869025395, rs869025365, rs869025469, rs869025483, rs749838192, rs869312028, rs869312037, rs869312038, rs869312039, rs869312040, rs869312041, rs869312042, rs869312044, rs869312046, rs373040154, rs869312047, rs869312048, rs869312049, rs869312050, rs869312051, rs869312052, rs869312054, rs869312055, rs777602537, rs869312056, rs869312057, rs869312058, rs869312059, rs869312060, rs770038577, rs869312061, rs869312062, rs869312063, rs869312064, rs869312065, rs869312066, rs869312067, rs869312068, rs869312069, rs771562210, rs869312070, rs869312071, rs759231562, rs869312072, rs869312073, rs764243269, rs768345594, rs869312074, rs869312075, rs869312076, rs869312077, rs869312078, rs869312079, rs869312080, rs772121356, rs869312081, rs869312082, rs72648250, rs869312083, rs869312084, rs869312085, rs869312086, rs869312087, rs869312100, rs779129892, rs756367933, rs869312102, rs869312103, rs869312104, rs869312105, rs869312106, rs770767998, rs869312107, rs775186117, rs869312108, rs869312109, rs869312110, rs869312111, rs755261062, rs869312112, rs763824247, rs869312113, rs869312114, rs869312115, rs869312116, rs774604740, rs869312117, rs779996703, rs869312118, rs869312119, rs869312120, rs869312121, rs869312122, rs869312045, rs753948675, rs878854371, rs794728589, rs876657650, rs727503512, rs876658027, rs876657672, rs876657671, rs868494032, rs876657670, rs780512337, rs876657669, rs876657668, rs876657666, rs876657665, rs876657664, rs876657663, rs148894066, rs876657634, rs869248137, rs876657705, rs876657704, rs727503213, rs869025496, rs876657662, rs876657884, rs36211715, rs878855234, rs879255521, rs879255639, rs886038928, rs751746401, rs886039030, rs869038795, rs886039343, rs2069544, rs1114167341, rs1114167340, rs886041322, rs886042331, rs886043718, rs747662439, rs886043924, rs773840992, rs886044536, rs1057517903, rs754354190, rs779650200, rs902082118, rs1057518920, rs1057519457, rs1057523045, rs370072439, rs1064792916, rs1060500495, rs1060500575, rs926741242, rs774763657, rs746877365, rs1060500610, rs1060501484, rs1060501479, rs1064792928, rs1060501443, rs1060499604, rs1064793814, rs1064796347, rs977277400, rs1064793429, rs745811346, rs1064794350, rs1555142963, rs1064793983, rs769665204, rs751261054, rs769139957, rs1131691873, rs1131691655, rs1131691673, rs1464253797, rs1408345511, rs1553603152, rs1554398705, rs1322596650, rs1553539995, rs1553611989, rs749961489, rs1444727212, rs1243301263, rs971618751, rs1553662326, rs1389777522, rs764985774, rs1554108287, rs1554105911, rs1249913357, rs1554108012, rs111806457, rs1402879259, rs748416758, rs794727046, rs1425855043, rs869178171, rs1432810664, rs749465164, rs878898365, rs1419374180, rs770878165, rs1553503113, rs1553691320, rs1553577362, rs1553603456, rs1417036453, rs1553741321, rs1553479603, rs1553607425, rs974671846, rs1420159591, rs745688425, rs1554875409, rs1555144459, rs1555338080, rs1555338574, rs1555148035, rs200889953, rs1401116572, rs1285329277, rs974510652, rs1263987728, rs1555122928, rs992189342, rs1555142971, rs1553261855, rs1553265647, rs1553488049, rs1553644307, rs1553663867, rs1553940122, rs28763965, rs758891557, rs762110595, rs1555436118, rs1555435531, rs565910322, rs376766195, rs1562168768, rs763443331, rs1562169661, rs1370579526, rs1561703922, rs1564773559, rs1559003939, rs1559598775, rs1559415567, rs1559877046, rs776970935, rs553526525, rs1561698362, rs1561694696, rs1561702640, rs730880751, rs1060505018, rs766330686, rs1565631430, rs1565050320, rs876657767, rs1565053085, rs1565053147, rs1557778277, rs1557776329, rs886039136, rs771262904, rs727504314, rs1563000044, rs541612157, rs766265889, rs1558988204, rs1559051231, rs1559262463, rs1559448864, rs1559469421, rs1559556267, rs1559746821, rs1559873786, rs1561323791, rs1561445221, rs1561686893, rs1561698714, rs1561702549, rs1565623439, rs1565623713, rs1565626367, rs1565627110, rs1565627145, rs397515889, rs1565628520, rs774316050, rs1592798444, rs1565590309, rs1566967399, rs1569552936, rs1559712733, rs1561690319, rs1561701721, rs869125101, rs1595843553, rs1576018303, rs746115846, rs777315336, rs1431206462, rs1572358674, rs1477669354, rs1575584918, rs1575614351, rs72648222, rs1575799625, rs1576014673, rs1576147786, rs747469275, rs1581805658, rs1227662860, rs1585169831, rs1592729525, rs762753884, rs1596155145, rs1572358821, rs991187915, rs1575649368, rs1060500562, rs1450218521, rs775256998, rs1572332762, rs1571627006, rs1575253896, rs1575616801, rs1575775337, rs1575948935, rs1574083547, rs1574087037, rs1589632398, rs1585171818, rs1603365762, rs768079285, rs1575663327, rs1575796530, rs1574659116, rs267607001, rs1567093598, rs1572359848, rs1060500505, rs1575512482, rs1575872984, rs1161735211, rs1576141328, rs906494713, rs1576685753, rs1266489077, rs1581813564, rs778808038, rs397516363, rs1596386673, rs1575610911, rs727503266, rs1603377936, rs777702465, rs1708504899, rs2054381012, rs1575285509, rs1695435412, rs1699247877, rs879139686, rs2060187635, rs761380979, rs1464886350, rs1956192035, rs752522753, rs1205836993, rs2095894178 |
|
Epidermolysis bullosa |
Epidermolysis Bullosa Progressiva, EPIDERMOLYSIS BULLOSA, JUNCTIONAL, LOCALISATA VARIANT (disorder) |
rs137852757, rs80356682, rs80356680, rs786205094, rs121912482, rs786205095, rs587776813, rs121912487, rs587776814, rs1558092501, rs80356683, rs118203899, rs118203900, rs1558095794, rs118203901, rs1558088792, rs121912466, rs2147483647, rs746056280, rs121912832, rs121912833, rs121912834, rs121912836, rs121912837, rs759990189, rs121912839, rs121912844, rs121912845, rs1575495784, rs121912848, rs121912849, rs121912851, rs121912852, rs121912853, rs121912854, rs121912855, rs121912769, rs1564673127, rs121912770, rs753898533, rs121912771, rs1589562891, rs2134563935, rs2134581672, rs121912772, rs121912773, rs121912774, rs121912856, rs201551805, rs769967565, rs786204774, rs797045084, rs886039330, rs886039412, rs1553277702, rs886041187, rs368007918, rs886041186, rs766902987, rs886041555, rs752657203, rs757415879, rs886058642, rs752317971, rs201307156, rs1057517096, rs774133746, rs772421306, rs758886532, rs144023803, rs1057517723, rs760063197, rs916512411, rs772381373, rs768128088, rs374718902, rs762162799, rs1064793916, rs780623622, rs747522386, rs1064793760, rs775196743, rs1131691385, rs201940939, rs200972872, rs139318843, rs1368134215, rs1203706188, rs772038362, rs1553281335, rs1181742615, rs1553853022, rs1553612928, rs1055680335, rs1057517023, rs760094345, rs1560241522, rs199527325, rs751535193, rs767539005, rs775244527, rs769808745, rs1032335328, rs1478395810, rs777672897, rs1575466699, rs776841521, rs1589572214, rs761388039, rs769294243, rs761927109, rs754621187 |
24550734 |
Epidermolysis bullosa dystrophica inversa |
Epidermolysis bullosa inversa dystrophica |
rs121912847, rs121912854, rs387906604, rs121912856, rs143457874, rs760891216, rs757415879, rs1057517723, rs760063197, rs775288140, rs201728948, rs768128088, rs757688782, rs1131691385, rs200972872, rs767182886, rs773263825, rs761234904, rs772756089 |
|
Junctional epidermolysis bullosa |
Junctional Epidermolysis Bullosa, Adult junctional epidermolysis bullosa (disorder), Intermediate generalized junctional epidermolysis bullosa, Severe generalized junctional epidermolysis bullosa |
rs80356682, rs121912482, rs786205095, rs769151482, rs118203901, rs121912467, rs121912468, rs121912769, rs80356681, rs370148688, rs770302956, rs778012079, rs201307156, rs1057516759, rs1057517096, rs1057516539, rs774133746, rs754289857, rs1064793896, rs775196743, rs747916314, rs759518184, rs1554848576, rs1210666598, rs1553266871, rs1418276828, rs1158945258, rs775244527, rs1558092158, rs1571803654, rs774734592, rs778026407 |
8012394, 16473856, 26956061, 27696112, 24550734, 16473856, 8012394 |
Junctional epidermolysis bullosa gravis of herlitz |
Herlitz Disease |
rs137852757, rs80356682, rs80356680, rs121912483, rs121912484, rs121912485, rs769151482, rs1558092501, rs80356683, rs118203899, rs80356681, rs80356679, rs80356678, rs151190720, rs767847211, rs753268823, rs146794392, rs201551805, rs769967565, rs776537364, rs371267954, rs786204732, rs886041893, rs1553277702, rs886045870, rs763559509, rs771613805, rs1057516806, rs1057517353, rs759509443, rs1057516410, rs745512079, rs1057516444, rs757617349, rs1057516218, rs774080932, rs1057516487, rs1057516569, rs778012079, rs776142807, rs1057516383, rs1057516727, rs1057516935, rs1057517159, rs1057516473, rs201307156, rs1057516400, rs1057516759, rs1057516756, rs777292177, rs1057516838, rs1057516486, rs1057517207, rs1057516822, rs1057516219, rs1057517096, rs1057517290, rs1057516316, rs1057517395, rs1057516249, rs1057516809, rs1057516539, rs1057516693, rs370148688, rs1057516947, rs1057516399, rs1057516241, rs1057517258, rs1057516675, rs1057517312, rs1057516884, rs1057516512, rs752030611, rs1057517023, rs1057516475, rs1057517235, rs1057517367, rs1057517314, rs1057516584, rs1057516688, rs1057516280, rs1057516476, rs1057517196, rs1057516279, rs1057516605, rs774133746, rs1057516764, rs1057517211, rs1057517272, rs1057517440, rs772421306, rs747916314, rs772038362, rs759518184, rs1553277267, rs1553265770, rs1553266052, rs1553266671, rs1553267345, rs1553267554, rs1553267679, rs1553267885, rs1178041263, rs1553279044, rs1553279073, rs1553265902, rs1479808203, rs1553266260, rs1553264644, rs1553266433, rs1553267638, rs1553265794, rs1553267882, rs1043996591, rs1553266537, rs774472247, rs1553267007, rs1553276216, rs1553266871, rs1553267356, rs1553267060, rs1553276430, rs1418276828, rs1553267499, rs1375506940, rs1186161867, rs1553277072, rs1553267870, rs1553275219, rs753711190, rs1553276110, rs1553276268, rs1464038626, rs1553281291, rs1553276488, rs1553277432, rs1553277686, rs778372285, rs1555724066, rs1555728701, rs747547191, rs1231716161, rs1555724108, rs1555728297, rs1555731178, rs1158945258, rs1555732431, rs1555730209, rs1555734356, rs1555737509, rs1555732032, rs765104557, rs1303193834, rs1555735252, rs1555736532, rs1555740963, rs754558574, rs1401574168, rs1555746079, rs1555736608, rs1555737629, rs1555740945, rs1555744812, rs1555754655, rs1555751482, rs1555721815, rs1555732528, rs1555737473, rs1555737779, rs1356353167, rs768415785, rs1555740717, rs1555745207, rs1555745317, rs1555754450, rs1234435123, rs1555720521, rs900100444, rs1555728319, rs1555732939, rs1555734513, rs141789403, rs1555743454, rs1555743457, rs1555744805, rs1555745263, rs34754160, rs1555751423, rs1555751529, rs1296034886, rs777672897, rs1571796718 |
11564184, 17916201, 11810295, 9085255, 16473856, 26956061, 11231327, 7849725, 27696112, 15373767, 8012394, 8983017 |
Lung carcinoma |
Non-Small Cell Lung Carcinoma |
rs1805076, rs121909071, rs121913530, rs112445441, rs121913529, rs121913535, rs121913297, rs121913279, rs104886003, rs397516975, rs11554290, rs121913364, rs121913351, rs121913369, rs121913355, rs121912470, rs121913273, rs121913281, rs121913348, rs727503093, rs121913353, rs397516890, rs397516896, rs121913378, rs397516897, rs397516977, rs397516978, rs397516979, rs397516980, rs397516981, rs397516982, rs121913240, rs17851045, rs397517086, rs121913428, rs397517094, rs397517098, rs397517106, rs121913465, rs397517108, rs397517111, rs397517112, rs397517114, rs397517116, rs1554350366, rs397517127, rs397517200, rs397517202, rs121913283, rs121913370, rs121913357, rs727503106, rs121913238, rs727503108, rs397517040, rs397516976, rs1555618025, rs1057519729, rs1584238193 |
30381462 |
Osteoporosis |
Osteoporosis |
rs72658152, rs72667023, rs587776916, rs72656370, rs768615287 |
|
Palmoplantar keratoderma |
Keratoderma, Palmoplantar |
rs59616921, rs1568039793, rs746488412, rs200564757, rs1567027297, rs781596375, rs1567027610, rs398123054, rs398123055, rs398123056, rs398123057, rs398122949, rs398122950, rs397515639, rs398122951, rs397515640, rs397515641, rs142859678, rs797044479, rs577442939, rs672601344, rs568609861, rs1057518846, rs1182196436, rs1567037561 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Alopecia |
Alopecia |
|
|
Ankyloglossia |
Ankyloglossia |
|
|
Congenital localized absence of skin |
Congenital localized absence of skin |
|
|
Dental enamel hypoplasia |
Dental Enamel Hypoplasia |
|
|
Esophageal stricture |
Esophageal Stricture |
|
|
Hypodontia |
Hypodontia |
|
|
Junctional epidermolysis bullosa inversa |
Junctional epidermolysis bullosa inversa |
|
|
Junctional split |
Junctional split |
|
|
Laryngospasm |
Laryngospasm |
|
|
Laryngostenosis |
Laryngostenosis |
|
|
Liver cirrhosis |
Liver Cirrhosis |
|
26396155 |
Liver fibrosis |
Fibrosis, Liver |
|
26396155 |
Lupus erythematosus |
Lupus Erythematosus, Systemic |
|
21408207 |
Microstomia |
Microstomia |
|
|
Nail diseases |
NAIL DISORDER, NONSYNDROMIC CONGENITAL, 9 |
|
|
Nail dysplasia |
Nail dysplasia |
|
|
Nail dystrophy |
Dystrophia unguium |
|
|
Onycholysis |
Onycholysis |
|
|
Paronychia inflammation |
Paronychia Inflammation |
|
|
Respiratory failure |
Respiratory Failure |
|
|
Skin carcinoma |
Squamous cell carcinoma of skin |
|
|
Skin erosion |
Skin Erosion |
|
|
|
|
|