Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
3868 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Keratin 16 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
KRT16 |
SynonymsGene synonyms aliases
|
CK16, FNEPPK, K16, K1CP, KRT16A, NEPPK, PC1 |
ChromosomeChromosome number
|
17 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
17q21.2 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs28928894 |
A>C,G,T |
Pathogenic, not-provided |
Missense variant, coding sequence variant |
rs28928895 |
A>G,T |
Pathogenic, not-provided |
Missense variant, coding sequence variant |
rs57424749 |
C>G,T |
Pathogenic, not-provided |
Missense variant, coding sequence variant |
rs58181827 |
AGG>- |
Pathogenic |
Inframe deletion, coding sequence variant |
rs58293603 |
A>C,G,T |
Pathogenic, not-provided |
Missense variant, coding sequence variant |
rs58608173 |
T>C |
Pathogenic |
Missense variant, coding sequence variant |
rs59328451 |
T>A |
Likely-pathogenic, pathogenic |
Missense variant, coding sequence variant |
rs59349773 |
T>C,G |
Likely-pathogenic, pathogenic, not-provided |
Missense variant, coding sequence variant |
rs59856285 |
G>A,C |
Pathogenic |
Missense variant, coding sequence variant |
rs60723330 |
T>C |
Pathogenic |
Missense variant, coding sequence variant |
rs60944949 |
A>G |
Pathogenic |
Missense variant, coding sequence variant |
rs587777717 |
TT>CC |
Pathogenic |
Coding sequence variant, missense variant |
rs1555573633 |
CGCCCTCCAGCAGGCGGCGGTAGGTGG>GCC |
Pathogenic |
Coding sequence variant, inframe indel |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Transcription factors
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P08779 |
Protein name |
Keratin, type I cytoskeletal 16 (Cytokeratin-16) (CK-16) (Keratin-16) (K16) |
Protein function |
Epidermis-specific type I keratin that plays a key role in skin. Acts as a regulator of innate immunity in response to skin barrier breach: required for some inflammatory checkpoint for the skin barrier maintenance. {ECO:0000250|UniProtKB:Q9Z2K1 |
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF00038 |
Filament |
116 → 427 |
Intermediate filament protein |
Coiled-coil |
|
Sequence |
|
Sequence length |
473 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Anonychia |
ANONYCHIA |
rs74315420, rs74315421, rs74315422, rs74315423, rs387907026, rs387907027, rs387907028, rs780261665, rs775644973, rs370554150 |
|
Cataract |
Cataract |
rs118203965, rs118203966, rs104893685, rs121908938, rs104894175, rs121909048, rs28937573, rs121909049, rs121909050, rs74315488, rs80358200, rs80358203, rs121434643, rs56141211, rs132630322, rs121917775, rs121917735, rs121917736, rs137853199, rs137853200, rs121917867, rs121917869, rs121913555, rs104893736, rs121909595, rs121909596, rs121909597, rs28931605, rs121909598, rs104893618, rs1695062782, rs74315486, rs74315487, rs74315490, rs74315489, rs745938679, rs1566402656, rs74315439, rs74315441, rs121912973, rs121917823, rs1593332981, rs121917825, rs121917827, rs113994108, rs387906963, rs387906964, rs1240503246, rs387906965, rs387906966, rs750207077, rs387907336, rs387907337, rs387907342, rs140332366, rs397514703, rs398122937, rs398122378, rs398122392, rs398122944, rs137853924, rs398122947, rs397515623, rs397515624, rs397515625, rs397515626, rs398122948, rs587778872, rs398123066, rs587777601, rs370424081, rs786205221, rs786205222, rs864309684, rs864309688, rs864309701, rs864309689, rs864309690, rs864309681, rs864309686, rs864309696, rs864309693, rs864309687, rs864309691, rs864309692, rs864309695, rs864309678, rs864309685, rs864309700, rs864309698, rs864309683, rs864309682, rs864309679, rs111534978, rs864309680, rs864309702, rs864622780, rs756898971, rs869312732, rs775038545, rs878852983, rs1114167312, rs1114167313, rs1114167314, rs1114167315, rs1114167307, rs886041410, rs886041412, rs1057518738, rs1057517926, rs1057518878, rs1057519616, rs12799308, rs1064793935, rs1064797219, rs1085307126, rs1085307127, rs765628635, rs1114167427, rs1114167433, rs1554744860, rs1554743428, rs747093432, rs1411557416, rs1555179713, rs1481963503, rs1555549755, rs1456161420, rs1555547008, rs1555889308, rs1555888762, rs766522434, rs1264025914, rs1553585262, rs1567671947, rs1337897299, rs764945940, rs1307969607, rs949335475, rs1184095219, rs776129797, rs1569203234, rs1567668570, rs749141857, rs764098604, rs1184398243, rs1578956689, rs1568480054, rs1564745688, rs1564722302, rs1564723150, rs1571175950, rs1569602837, rs1576552712, rs1575369255, rs981126461, rs1570403798, rs200557771, rs1477743112, rs1651879427, rs1651881222, rs1651919374, rs2024441691, rs148284531, rs1246080692 |
|
Corneal dystrophy |
Corneal dystrophy |
rs121909212, rs121909214, rs760714959, rs766305306, rs1554579819, rs1554579832, rs1554579878 |
|
Ichthyosis |
Ichthyoses |
rs199766569, rs587776996, rs587777262, rs863223405, rs370031870, rs1569044747, rs200806519 |
|
Isolated focal non-epidermolytic palmoplantar keratoderma |
Isolated focal non-epidermolytic palmoplantar keratoderma |
rs786205868, rs786205869, rs1057517884 |
|
Keratosis pilaris |
Keratosis pilaris |
rs483353013 |
|
Pachyonychia congenita |
Pachyonychia Congenita, Pachyonychia Congenita, Jadassohn Lewandowsky Type, Pachyonychia Congenita, Type 2 (disorder) |
rs60944949, rs59856285, rs60723330, rs58181827, rs57424749, rs59349773, rs58293603, rs28928894, rs28928895, rs60627726, rs606231214, rs28933087, rs60554162, rs57052654, rs267607468, rs57126929, rs62635294, rs58556099, rs59685571, rs61145796, rs267607473, rs267607472, rs58608173, rs113369052, rs587777717, rs1592169234 |
24118415, 16250206, 7539673, 10839714, 11359398, 10606845, 10521820, 21160496, 21326300, 11886499, 22668561, 17719747 |
Palmoplantar keratoderma |
Keratoderma, Palmoplantar |
rs59616921, rs1568039793, rs746488412, rs200564757, rs1567027297, rs781596375, rs1567027610, rs398123054, rs398123055, rs398123056, rs398123057, rs398122949, rs398122950, rs397515639, rs398122951, rs397515640, rs397515641, rs142859678, rs797044479, rs577442939, rs672601344, rs568609861, rs1057518846, rs1182196436, rs1567037561 |
|
Nonepidermolytic palmoplantar keratoderma |
PALMOPLANTAR KERATODERMA, NONEPIDERMOLYTIC, FOCAL 1 |
rs59856285, rs60723330, rs1555573633, rs57977969, rs60447237, rs267607424, rs587777292 |
7539673, 21160496, 8595410 |
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Alopecia |
Alopecia |
|
|
Urinary bladder cancer |
Malignant neoplasm of urinary bladder |
|
20186695 |
Bladder neoplasm |
Bladder Neoplasm |
|
20186695 |
Eczema |
Eczema |
|
|
Epidermolytic palmoplantar keratoderma |
Epidermolytic palmoplantar keratoderma, Keratoderma, Palmoplantar, Epidermolytic |
|
8595410 |
Epidermolytic palmoplantar keratoderma of vorner |
Epidermolytic palmoplantar keratoderma of Vorner, Epidermolytic palmoplantar keratoderma Vorner type |
|
8595410 |
Impaired cognition |
Impaired cognition |
|
|
Laryngomalacia |
Laryngomalacia |
|
|
Leukoplakia |
Leukoplakia, Oral |
|
|
Nail dystrophy |
Dystrophia unguium |
|
|
Onychogryposis |
Onychogryposis |
|
|
Palmoplantar keratosis |
Palmoplantar Keratosis |
|
|
Phrynoderma |
Phrynoderma |
|
|
|
|
|