IVD (isovaleryl-CoA dehydrogenase)
|
| Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
3712 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Isovaleryl-CoA dehydrogenase |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
IVD |
SynonymsGene synonyms aliases
|
ACAD2, IVDH |
ChromosomeChromosome number
|
15 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
15q15.1 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to |
SNPsSNP information provided by dbSNP.
|
| SNP ID |
Visualize variation |
Clinical significance |
Consequence |
| rs2229311 |
G>A,C,T |
Pathogenic-likely-pathogenic |
Missense variant, non coding transcript variant, coding sequence variant, intron variant |
| rs28940889 |
C>T |
Pathogenic |
Non coding transcript variant, missense variant, genic downstream transcript variant, coding sequence variant |
| rs34695403 |
C>G,T |
Uncertain-significance, likely-pathogenic |
Non coding transcript variant, intron variant, missense variant, coding sequence variant |
| rs121434284 |
T>C |
Pathogenic |
Coding sequence variant, upstream transcript variant, missense variant, genic upstream transcript variant, non coding transcript variant, 5 prime UTR variant |
| rs121434285 |
G>T |
Uncertain-significance, pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
| rs140098686 |
C>T |
Conflicting-interpretations-of-pathogenicity |
Non coding transcript variant, intron variant, synonymous variant, coding sequence variant |
| rs142761835 |
G>A |
Pathogenic-likely-pathogenic, pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
| rs143348838 |
G>A |
Likely-pathogenic, uncertain-significance |
Coding sequence variant, missense variant, non coding transcript variant, genic downstream transcript variant, intron variant |
| rs145999491 |
A>T |
Uncertain-significance, conflicting-interpretations-of-pathogenicity |
Non coding transcript variant, intron variant, missense variant, coding sequence variant |
| rs146861563 |
C>T |
Likely-pathogenic, uncertain-significance |
Missense variant, non coding transcript variant, coding sequence variant |
| rs367814475 |
G>C,T |
Pathogenic |
Coding sequence variant, genic downstream transcript variant, non coding transcript variant, missense variant |
| rs368705240 |
C>T |
Pathogenic |
Intron variant, downstream transcript variant, coding sequence variant, genic downstream transcript variant, non coding transcript variant, stop gained |
| rs371427844 |
C>T |
Pathogenic |
Missense variant, intron variant, coding sequence variant, genic downstream transcript variant, non coding transcript variant |
| rs373534546 |
G>A,T |
Conflicting-interpretations-of-pathogenicity |
Missense variant, downstream transcript variant, coding sequence variant, genic downstream transcript variant, non coding transcript variant |
| rs373594717 |
A>C,G,T |
Likely-pathogenic |
Upstream transcript variant, genic upstream transcript variant, missense variant, initiator codon variant, non coding transcript variant, 5 prime UTR variant |
| rs377147994 |
G>A |
Pathogenic |
Splice donor variant |
| rs398123679 |
G>A |
Conflicting-interpretations-of-pathogenicity, likely-pathogenic |
Missense variant, intron variant, coding sequence variant, genic downstream transcript variant, non coding transcript variant |
| rs398123680 |
T>C |
Likely-pathogenic |
Missense variant, intron variant, downstream transcript variant, coding sequence variant, genic downstream transcript variant, non coding transcript variant |
| rs398123681 |
C>G,T |
Uncertain-significance, pathogenic-likely-pathogenic |
Missense variant, intron variant, coding sequence variant, genic downstream transcript variant, non coding transcript variant, stop gained |
| rs398123682 |
TG>- |
Likely-pathogenic, pathogenic |
Coding sequence variant, non coding transcript variant, frameshift variant |
| rs398123683 |
T>C |
Pathogenic |
Splice donor variant |
| rs398123684 |
G>- |
Pathogenic |
Coding sequence variant, non coding transcript variant, frameshift variant |
| rs540375168 |
G>A |
Pathogenic |
Stop gained, coding sequence variant, non coding transcript variant |
| rs566691073 |
T>C,G |
Likely-pathogenic, uncertain-significance |
Genic upstream transcript variant, 5 prime UTR variant, upstream transcript variant, initiator codon variant, non coding transcript variant, missense variant |
| rs745629936 |
G>A |
Likely-pathogenic |
Downstream transcript variant, splice donor variant, genic downstream transcript variant |
| rs757261752 |
A>C,T |
Likely-pathogenic |
Initiator codon variant, missense variant, 5 prime UTR variant, upstream transcript variant, non coding transcript variant, genic upstream transcript variant, coding sequence variant |
| rs759159766 |
->G |
Pathogenic |
Downstream transcript variant, coding sequence variant, frameshift variant, non coding transcript variant, genic downstream transcript variant |
| rs763422682 |
T>C |
Conflicting-interpretations-of-pathogenicity |
Missense variant, coding sequence variant, intron variant, non coding transcript variant, genic downstream transcript variant |
| rs763471771 |
G>A |
Pathogenic |
Splice donor variant |
| rs765815516 |
C>T |
Pathogenic |
Intron variant, non coding transcript variant, stop gained, coding sequence variant |
| rs769048174 |
T>- |
Pathogenic |
Frameshift variant, non coding transcript variant, coding sequence variant |
| rs771914739 |
A>C,G |
Likely-pathogenic |
Splice acceptor variant |
| rs773560012 |
A>G |
Pathogenic-likely-pathogenic |
Intron variant, coding sequence variant, non coding transcript variant, genic downstream transcript variant, missense variant |
| rs776015412 |
C>T |
Likely-pathogenic |
Stop gained, coding sequence variant, non coding transcript variant |
| rs776608445 |
C>G,T |
Pathogenic, uncertain-significance |
Intron variant, coding sequence variant, non coding transcript variant, genic downstream transcript variant, missense variant |
| rs781630355 |
T>- |
Pathogenic, conflicting-interpretations-of-pathogenicity |
Frameshift variant, coding sequence variant, non coding transcript variant |
| rs786204427 |
CA>GG |
Likely-pathogenic |
Intron variant, splice acceptor variant |
| rs786204613 |
T>- |
Pathogenic-likely-pathogenic, likely-pathogenic |
Intron variant, coding sequence variant, non coding transcript variant, frameshift variant, genic downstream transcript variant |
| rs796051982 |
->GTG |
Likely-pathogenic |
Inframe insertion, coding sequence variant, non coding transcript variant |
| rs796051983 |
C>T |
Likely-pathogenic |
Missense variant, coding sequence variant, genic downstream transcript variant, non coding transcript variant |
| rs907414760 |
G>A,C |
Likely-pathogenic |
5 prime UTR variant, genic upstream transcript variant, non coding transcript variant, missense variant, upstream transcript variant, coding sequence variant, stop gained |
| rs928991928 |
G>A,C |
Likely-pathogenic |
5 prime UTR variant, upstream transcript variant, splice donor variant, non coding transcript variant, genic upstream transcript variant |
| rs982218848 |
G>A |
Pathogenic |
Genic downstream transcript variant, intron variant, non coding transcript variant, missense variant, coding sequence variant |
| rs1057516769 |
->T |
Likely-pathogenic |
Stop gained, non coding transcript variant, coding sequence variant |
| rs1057517043 |
G>A |
Likely-pathogenic |
Splice acceptor variant |
| rs1057517056 |
A>G |
Likely-pathogenic |
Intron variant, genic downstream transcript variant, splice acceptor variant |
| rs1057517379 |
CG>- |
Likely-pathogenic |
Frameshift variant, genic upstream transcript variant, 5 prime UTR variant, upstream transcript variant, non coding transcript variant, coding sequence variant |
| rs1057524715 |
T>A |
Likely-pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
| rs1237032588 |
C>T |
Pathogenic |
Missense variant, intron variant, coding sequence variant, genic downstream transcript variant, non coding transcript variant |
| rs1364046355 |
C>- |
Pathogenic |
Frameshift variant, coding sequence variant, non coding transcript variant |
| rs1398838997 |
G>A |
Likely-pathogenic |
Splice acceptor variant |
| rs1477527791 |
G>A |
Conflicting-interpretations-of-pathogenicity |
Genic downstream transcript variant, coding sequence variant, missense variant, non coding transcript variant, intron variant |
| rs1555403211 |
->ATGG |
Likely-pathogenic |
Coding sequence variant, intron variant, non coding transcript variant, frameshift variant |
| rs1555403942 |
ACACGCTAATCTCACAGTGCAACCACCAACTAAAAGATACCCTCTCCCCTTGGGGGCCAGTCAGACCTGCTTTCTGTAGCATGCTGCCATGAACCAAATGTGGTTAGGAAGGGGCCATGGATTGCTTTAAAATACTTGAGCCAAAAATAATAAAAATAGGACCAGAACTCTTGCATTGAACAACAGACAGACAACATTTGAAGAGAACTCTAAGAAATGGAAGAGTAGGACTAGCTTCCTTTGCAAAGGGAATGG |
Likely-pathogenic |
Splice acceptor variant, coding sequence variant, non coding transcript variant, intron variant |
| rs1555404010 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant, non coding transcript variant |
| rs1555404426 |
->T |
Likely-pathogenic |
Stop gained, coding sequence variant, non coding transcript variant |
| rs1555404784 |
G>A |
Likely-pathogenic |
Splice acceptor variant, 3 prime UTR variant, non coding transcript variant |
| rs1555405067 |
G>T |
Likely-pathogenic |
Splice acceptor variant, intron variant, genic downstream transcript variant |
| rs1555405070 |
A>- |
Likely-pathogenic |
Genic downstream transcript variant, coding sequence variant, frameshift variant, non coding transcript variant, intron variant |
| rs1555405080 |
C>- |
Likely-pathogenic |
Genic downstream transcript variant, coding sequence variant, frameshift variant, non coding transcript variant, intron variant |
| rs1555405428 |
GGCGGCTGGTCATCGGCAGAGCCTTCAA>- |
Likely-pathogenic |
Genic downstream transcript variant, coding sequence variant, frameshift variant, non coding transcript variant, intron variant |
| rs1566936542 |
C>- |
Likely-pathogenic |
Non coding transcript variant, coding sequence variant, frameshift variant |
| rs1595786853 |
A>T |
Likely-pathogenic |
Non coding transcript variant, downstream transcript variant, missense variant, coding sequence variant, genic downstream transcript variant |
| rs1595797766 |
A>- |
Pathogenic |
Non coding transcript variant, intron variant, coding sequence variant, frameshift variant, genic downstream transcript variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
| Protein
|
| UniProt ID |
P26440 |
| Protein name |
Isovaleryl-CoA dehydrogenase, mitochondrial (IVD) (EC 1.3.8.4) (Butyryl-CoA dehydrogenase) (EC 1.3.8.1) |
| Protein function |
Catalyzes the conversion of isovaleryl-CoA/3-methylbutanoyl-CoA to 3-methylbut-2-enoyl-CoA as an intermediate step in the leucine (Leu) catabolic pathway (PubMed:7640268). To a lesser extent, is also able to catalyze the oxidation of other satur |
| PDB |
1IVH
,
8SGR
|
| Family and domains |
Pfam
| Accession |
ID |
Position in sequence |
Description |
Type |
| PF02771 |
Acyl-CoA_dh_N |
46 → 160 |
Acyl-CoA dehydrogenase, N-terminal domain |
Domain |
| PF02770 |
Acyl-CoA_dh_M |
164 → 261 |
Acyl-CoA dehydrogenase, middle domain |
Domain |
| PF00441 |
Acyl-CoA_dh_1 |
273 → 421 |
Acyl-CoA dehydrogenase, C-terminal domain |
Domain |
|
Sequence |
|
| Sequence length |
426 |
| Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
| Associated diseases
|
| Causal |
| Disease name |
Disease term |
dbSNP ID |
References |
| Developmental delay |
Global developmental delay |
rs28941770, rs199469464, rs281865469, rs143747297, rs398123009, rs587777428, rs786205133, rs606231459, rs797044854, rs797045027, rs864309504, rs878853160, rs886039902, rs886042046, rs886041291, rs886041382, rs1057518991, rs1057518699, rs753254213, rs748294403, rs762552974, rs1135401795, rs1553121073, rs1553122926, rs1364690005, rs1554086554, rs1554210415, rs1554168326, rs1554776342, rs1553873247, rs1567860112, rs779009256, rs1557447255, rs1564568350, rs780011005, rs1597464953, rs1200336864, rs1569513017, rs1587459606, rs1570332505, rs748888652, rs1575155995, rs2087029320, rs1589669105, rs1601769604, rs1184981709, rs749201074 |
|
| Isovaleric acidemia |
Isovaleric acidemia |
rs121434284 |
|
| Isovaleryl-coa dehydrogenase deficiency |
Isovaleryl-CoA dehydrogenase deficiency |
rs34695403, rs28940889, rs398123682, rs398123683, rs398123684, rs142761835, rs2229311, rs786204427, rs771914739, rs786204613, rs763471771, rs747273828, rs748026507, rs796051983, rs371427844, rs368705240, rs1057517379, rs928991928, rs765815516, rs1057517043, rs1057516769, rs1057517056, rs773560012, rs1555404010, rs1314850102, rs759159766, rs1555403942, rs769048174, rs781630355, rs1477527791, rs907414760, rs776015412, rs1555405067, rs1555405428, rs1398838997, rs1555404784, rs1555403211, rs1555404426, rs745629936, rs1555405070, rs1555405080, rs398123681, rs1566936542, rs1364046355, rs982218848, rs1595786853, rs754600862, rs540375168, rs776608445, rs1595797766, rs1237032588, rs1890343709, rs568885234, rs1891639284, rs745464766, rs1891674455 |
1310317, 24019846, 22960500, 27629047, 22004070, 22350545, 24637313, 20519759, 2063866, 6630517, 2318964, 17027310, 23587913, 9665741, 15486829, 26937393, 27904153, 24516753, 16602101, 19099814, 15337167, 16825284, 17576084, 24816252, 25220015, 28535199, 10713113, 10677295, 30709776, 26018748 |
| Myocardial infarction |
Myocardial Infarction |
rs12316150, rs41303970, rs909253, rs7291467, rs2234693 |
21211798 |
| Pancytopenia |
Pancytopenia |
rs869312883, rs770551610, rs1131690788, rs530073586, rs374333820 |
|
|
| Unknown |
| Disease name |
Disease term |
dbSNP ID |
References |
| Hyperglycinuria |
HYPERGLYCINURIA (disorder) |
rs35329108, rs77010315, rs371203963, rs17279437, rs569114783, rs886058526, rs2742388, rs17078308, rs763196010, rs539802611, rs570836605, rs531832972, rs368608688, rs774194927, rs886058536, rs73060335, rs60986539, rs371002443, rs144563792, rs775911371, rs747095857, rs758386, rs561215947, rs2742399, rs777914805, rs373219947, rs2271616, rs2251109, rs886058525, rs886058527, rs554759297, rs747117264, rs150768360, rs541425547, rs17213127, rs577430886, rs886058529, rs560591051, rs57468640, rs866725621, rs144151884, rs116590098, rs9811206, rs886058535, rs886058537, rs553024616, rs886058538, rs202094508, rs144826762, rs771872725, rs139940581, rs13314717, rs373600065, rs886058548, rs567898651, rs115438130, rs530275150, rs778688066, rs886058530, rs139410525, rs886058534, rs2531750, rs2251347, rs541823457, rs886058539, rs376448611, rs886058541, rs139256040, rs148597602, rs149854452, rs34458611, rs2276858, rs886058544, rs779053318, rs202049492, rs565896481, rs886058546, rs2271615, rs760366170, rs886058547, rs562961153, rs116082988, rs886058528, rs886058531, rs886058532, rs886058533, rs535180634, rs149175344, rs886058540, rs575264353, rs2191027, rs147777980, rs886058542, rs886058543, rs886058545, rs145164127, rs781203780, rs886058549, rs766388628, rs756010661 |
|
| Ketosis |
Ketosis |
|
|
| Leukopenia |
Leukopenia |
|
|
| Lung diseases |
Lung Diseases, Interstitial |
|
23583980 |
|
|
|
