ITGB4 (integrin subunit beta 4)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
3691 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Integrin subunit beta 4 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
ITGB4 |
SynonymsGene synonyms aliases
|
CD104, GP150, JEB5A, JEB5B |
ChromosomeChromosome number
|
17 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
17q25.1 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
Integrins are heterodimers comprised of alpha and beta subunits, that are noncovalently associated transmembrane glycoprotein receptors. Different combinations of alpha and beta polypeptides form complexes that vary in their ligand-binding specificities. |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs80338755 |
G>A |
Pathogenic |
Genic upstream transcript variant, missense variant, coding sequence variant |
rs121912461 |
T>C |
Pathogenic |
Coding sequence variant, genic upstream transcript variant, missense variant |
rs121912462 |
C>A,T |
Pathogenic |
Stop gained, upstream transcript variant, coding sequence variant, synonymous variant, genic upstream transcript variant |
rs121912463 |
T>C |
Pathogenic |
Missense variant, coding sequence variant, genic upstream transcript variant, upstream transcript variant |
rs121912464 |
G>A |
Pathogenic |
Coding sequence variant, intron variant, stop gained |
rs121912465 |
T>C |
Pathogenic |
Coding sequence variant, genic upstream transcript variant, missense variant |
rs121912466 |
G>A |
Pathogenic |
Coding sequence variant, missense variant |
rs121912467 |
C>A,T |
Pathogenic |
Coding sequence variant, synonymous variant, missense variant |
rs121912468 |
G>A,T |
Pathogenic |
Coding sequence variant, missense variant |
rs145976111 |
C>T |
Conflicting-interpretations-of-pathogenicity, uncertain-significance |
Coding sequence variant, missense variant |
rs147222357 |
G>A,T |
Pathogenic |
Splice donor variant |
rs148770294 |
C>A,G,T |
Likely-pathogenic |
Missense variant, genic upstream transcript variant, coding sequence variant |
rs752657203 |
C>-,CC |
Pathogenic |
Coding sequence variant, frameshift variant, genic upstream transcript variant |
rs758551913 |
A>G |
Likely-pathogenic |
Splice acceptor variant |
rs762236241 |
T>C |
Likely-pathogenic |
Splice donor variant |
rs772142634 |
C>T |
Likely-pathogenic |
Stop gained, coding sequence variant |
rs794726676 |
G>- |
Pathogenic |
Frameshift variant, coding sequence variant, intron variant |
rs886041205 |
->T |
Pathogenic |
Splice donor variant |
rs1064795468 |
AGGGCCCTGGCTCA>- |
Likely-pathogenic |
Intron variant |
rs1178371226 |
AG>- |
Pathogenic |
Frameshift variant, coding sequence variant, intron variant |
rs1480399395 |
CGGCGCTGCAACACCCAGGCGGAGCTGCTGGCC>- |
Pathogenic |
Inframe deletion, genic upstream transcript variant, coding sequence variant |
rs1568366397 |
C>A |
Pathogenic |
Coding sequence variant, stop gained |
rs1568385656 |
TGGC>- |
Pathogenic |
Frameshift variant, coding sequence variant, intron variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Transcription factors
|
Transcription factor |
Regulation |
Reference |
ZEB1 |
Unknown |
20729552 |
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
GO ID |
Ontology |
Definition |
Evidence |
Reference |
GO:0001664 |
Function |
G protein-coupled receptor binding |
IPI |
24851274 |
GO:0005178 |
Function |
Integrin binding |
IBA |
21873635 |
GO:0005515 |
Function |
Protein binding |
IPI |
2649503, 11375975, 12482924, 19242489, 19403692, 20603614, 21880726, 24007983, 24851274, 25703379, 27178753 |
GO:0005604 |
Component |
Basement membrane |
IEA |
|
GO:0005730 |
Component |
Nucleolus |
IDA |
|
GO:0005886 |
Component |
Plasma membrane |
IDA |
21310825, 24851274 |
GO:0005886 |
Component |
Plasma membrane |
TAS |
|
GO:0005925 |
Component |
Focal adhesion |
IBA |
21873635 |
GO:0006914 |
Process |
Autophagy |
IMP |
24007983 |
GO:0007155 |
Process |
Cell adhesion |
NAS |
2311577 |
GO:0007160 |
Process |
Cell-matrix adhesion |
IBA |
21873635 |
GO:0007160 |
Process |
Cell-matrix adhesion |
IMP |
23496044 |
GO:0007229 |
Process |
Integrin-mediated signaling pathway |
IBA |
21873635 |
GO:0008305 |
Component |
Integrin complex |
IBA |
21873635 |
GO:0008305 |
Component |
Integrin complex |
IEA |
|
GO:0009611 |
Process |
Response to wounding |
IDA |
19403692 |
GO:0009925 |
Component |
Basal plasma membrane |
IEA |
|
GO:0009986 |
Component |
Cell surface |
IBA |
21873635 |
GO:0009986 |
Component |
Cell surface |
IDA |
19933311, 21310825 |
GO:0016477 |
Process |
Cell migration |
IBA |
21873635 |
GO:0030054 |
Component |
Cell junction |
IDA |
|
GO:0030056 |
Component |
Hemidesmosome |
IDA |
12482924 |
GO:0030198 |
Process |
Extracellular matrix organization |
TAS |
|
GO:0031252 |
Component |
Cell leading edge |
IDA |
19403692 |
GO:0031581 |
Process |
Hemidesmosome assembly |
IDA |
12482924 |
GO:0031581 |
Process |
Hemidesmosome assembly |
IMP |
23496044 |
GO:0031581 |
Process |
Hemidesmosome assembly |
TAS |
|
GO:0031965 |
Component |
Nuclear membrane |
IDA |
|
GO:0031994 |
Function |
Insulin-like growth factor I binding |
IDA |
22351760 |
GO:0032290 |
Process |
Peripheral nervous system myelin formation |
IEA |
|
GO:0033627 |
Process |
Cell adhesion mediated by integrin |
IBA |
21873635 |
GO:0035878 |
Process |
Nail development |
IMP |
23496044 |
GO:0038132 |
Function |
Neuregulin binding |
IDA |
20682778 |
GO:0043235 |
Component |
Receptor complex |
IDA |
23382219 |
GO:0043589 |
Process |
Skin morphogenesis |
IMP |
23496044 |
GO:0046847 |
Process |
Filopodium assembly |
IEA |
|
GO:0048333 |
Process |
Mesodermal cell differentiation |
IEP |
23154389 |
GO:0048870 |
Process |
Cell motility |
IMP |
19403692 |
GO:0061450 |
Process |
Trophoblast cell migration |
IEA |
|
GO:0070062 |
Component |
Extracellular exosome |
HDA |
19199708 |
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P16144 |
Protein name |
Integrin beta-4 (GP150) (CD antigen CD104) |
Protein function |
Integrin alpha-6/beta-4 is a receptor for laminin. Plays a critical structural role in the hemidesmosome of epithelial cells. Is required for the regulation of keratinocyte polarity and motility. ITGA6:ITGB4 binds to NRG1 (via EGF domain) and th |
PDB |
1QG3
,
2YRZ
,
3F7P
,
3F7Q
,
3F7R
,
3FQ4
,
3FSO
,
3H6A
,
4Q58
,
4WTW
,
4WTX
,
6GVK
,
6GVL
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF17205 |
PSI_integrin |
28 → 73 |
Integrin plexin domain |
Domain |
PF00362 |
Integrin_beta |
125 → 370 |
Integrin beta chain VWA domain |
Domain |
PF18372 |
I-EGF_1 |
457 → 485 |
Integrin beta epidermal growth factor like domain 1 |
Domain |
PF07974 |
EGF_2 |
543 → 573 |
EGF-like domain |
Domain |
PF07965 |
Integrin_B_tail |
626 → 710 |
Integrin beta tail domain |
Domain |
PF03160 |
Calx-beta |
979 → 1084 |
Calx-beta domain |
Domain |
PF00041 |
fn3 |
1128 → 1208 |
Fibronectin type III domain |
Domain |
PF00041 |
fn3 |
1221 → 1310 |
Fibronectin type III domain |
Domain |
PF00041 |
fn3 |
1529 → 1612 |
Fibronectin type III domain |
Domain |
PF00041 |
fn3 |
1642 → 1728 |
Fibronectin type III domain |
Domain |
|
Sequence |
|
Sequence length |
1822 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Adenocarcinoma |
Adenoid Cystic Carcinoma |
rs121913530, rs886039394, rs121913474 |
16762588 |
Amelogenesis imperfecta |
Amelogenesis Imperfecta |
rs267607178, rs143816093, rs606231351, rs137854435, rs137854440, rs137854441, rs137854444, rs587776587, rs121908109, rs587776588, rs140213840, rs104894704, rs387906487, rs387906488, rs387906489, rs104894733, rs104894734, rs104894736, rs387906490, rs387906491, rs104894737, rs104894738, rs144411158, rs587776911, rs587776912, rs587776913, rs587776914, rs387907215, rs866941536, rs1560562738, rs1560562630, rs146645381, rs1560558455, rs587777515, rs587777516, rs587777530, rs139620139, rs587777531, rs587777535, rs587777536, rs587777537, rs606231462, rs1553275034, rs869320671, rs786201004, rs140015315, rs730882118, rs730880297, rs730880298, rs786204825, rs786204826, rs1555409827, rs1057517671, rs1057517672, rs556734208, rs146238585, rs202073531, rs1057519277, rs767907487, rs779823931, rs1060499539, rs1085307111, rs546603773, rs1553275070, rs1553275195, rs752102959, rs1554623490, rs1553888384, rs770804941, rs1553887511, rs557128345, rs1568724130, rs199527325, rs1603038146, rs773117913, rs1560973571, rs1560782372, rs1560980659, rs1560973467, rs772929908, rs762816338, rs1565222166, rs1595312054, rs1866200282, rs2086254952 |
|
Anemia |
Anemia |
rs118204044, rs118204045, rs118204046, rs121918330, rs869320719, rs869312029, rs121918332, rs869320724, rs767094129, rs786205058, rs786205059, rs137853119, rs137853120, rs137853121, rs1384933966, rs137853122, rs137853123, rs786205060, rs267607121, rs121908584, rs80338697, rs80338699, rs120074166, rs120074167, rs1050828, rs74575103, rs137852314, rs5030868, rs137852316, rs137852317, rs137852318, rs137852319, rs137852320, rs137852321, rs137852322, rs137852323, rs137852324, rs72554665, rs387906468, rs5030872, rs137852326, rs137852333, rs137852327, rs137852328, rs137852329, rs137852330, rs137852331, rs137852332, rs137852334, rs137852335, rs137852336, rs137852339, rs76645461, rs137852340, rs137852341, rs78478128, rs137852343, rs137852344, rs137852345, rs587776730, rs137852346, rs137852347, rs137852349, rs2070404412, rs2070350038, rs2070350009, rs137852303, rs137852304, rs33946267, rs34378160, rs33933298, rs11549407, rs35724775, rs34598529, rs41469945, rs267607201, rs80338694, rs80338696, rs387907018, rs398123546, rs78365220, rs587777100, rs587777101, rs483352840, rs869312752, rs765487627, rs1557229599, rs1557230040, rs1555524842, rs782090947, rs1358275550, rs1557229736, rs1557230573, rs1556323334, rs1233124208, rs1293528130, rs146864395, rs1595503440, rs1603411214, rs137852325, rs1575247302, rs1603411177, rs1336651679, rs782322505 |
|
Anonychia |
ANONYCHIA |
rs74315420, rs74315421, rs74315422, rs74315423, rs387907026, rs387907027, rs387907028, rs780261665, rs775644973, rs370554150 |
|
Aplasia cutis congenita |
Aplasia Cutis Congenita |
rs587777706 |
18348258, 31184804 |
Arthrogryposis multiplex congenita |
Arthrogryposis |
rs1586285494, rs80358233, rs137853305, rs1559154278, rs398124167, rs398124172, rs587780399, rs786204576, rs786204430, rs769345284, rs749355583, rs793888524, rs793888525, rs878854368, rs555445835, rs758105619, rs886041851, rs794727136, rs755239192, rs760715690, rs773952935, rs112610938, rs1057516676, rs1057516996, rs780022652, rs1057517399, rs1057517360, rs1057518353, rs1057517977, rs1064796311, rs779232987, rs775997446, rs1064797093, rs1064797094, rs1064797095, rs755500591, rs754272530, rs758247804, rs200731870, rs747179265, rs1553740233, rs776569219, rs375628303, rs775631800, rs781667543, rs1553548666, rs928945364, rs763364977, rs1458048713, rs1553883480, rs1472403020, rs1336053002, rs202048855, rs1197561990, rs755531536, rs1554112524, rs762133567, rs1553555882, rs934111355, rs1255744452, rs1366269616, rs1555734932, rs1553548207, rs752582527, rs1257495033, rs113525641, rs755863625, rs374929094, rs539819851, rs1366853918, rs1218073575, rs1553537512, rs1553552384, rs747564597, rs776059611, rs756726488, rs1357811155, rs1553939600, rs772009599, rs1255445731, rs1011425121, rs1553561697, rs1553551748, rs1553552413, rs760935667, rs1553603400, rs1302373559, rs1389892619, rs1553710982, rs757157808, rs1180339426, rs761964375, rs1235589246, rs1443738549, rs1553934586, rs1553934597, rs1553603437, rs749452641, rs1553904694, rs754369875, rs112517981, rs774495973, rs1428597732, rs746999970, rs113091511, rs1553603958, rs1553469502, rs770797137, rs1553608621, rs1159756073, rs776167256, rs778593702, rs1553601066, rs1553689774, rs760768475, rs1559296376, rs201636991, rs1559039815, rs748922882, rs772366030, rs1207534366, rs1259297878, rs762780413, rs1559360386, rs1559940778, rs760200697, rs1344099907, rs750900690, rs1559168230, rs746177326, rs761067911, rs1323364980, rs537560378, rs1319778592, rs1340063197, rs1577833924, rs750585238, rs1600470099, rs1575714905, rs1576203853, rs779909544, rs760124743, rs2096362304, rs1212374733, rs1490309743, rs767709270, rs1374971806, rs2096491549, rs2097886912, rs2099021112, rs2097758221, rs1474341248, rs925947627 |
|
Ectodermal dysplasia |
Ectodermal Dysplasia |
rs74315309, rs121908116, rs1558814967, rs121908450, rs121908452, rs121908453, rs797044435, rs121908454, rs121908455, rs121908456, rs797044436, rs797044437, rs137853324, rs137853325, rs137853326, rs137853327, rs137853328, rs137853329, rs1569556603, rs2147483647, rs137853330, rs28933100, rs121913665, rs387907197, rs386134238, rs386134240, rs782540538, rs398122913, rs398122377, rs179363867, rs1565766888, rs747806672, rs879255553, rs886039564, rs886041005, rs766500689, rs886041411, rs782178147, rs1057519508, rs1057524917, rs139455627, rs1060499610, rs1553445945, rs1553448320, rs557166582, rs1569151872, rs1555916009, rs1566591076, rs1566591086, rs1566591082, rs1558814135, rs773885029, rs1590674994, rs1575653629, rs1575647025, rs781890406, rs749688157 |
18348258 |
Epidermolysis bullosa |
Epidermolysis Bullosa, Epidermolysis Bullosa Herpetiformis Dowling-Meara, Epidermolysis Bullosa Progressiva, Epidermolysis Bullosa Simplex Kobner, Epidermolysis bullosa with pyloric atresia, EPIDERMOLYSIS BULLOSA, JUNCTIONAL, LOCALISATA VARIANT (disorder), Localized junctional epidermolysis bullosa |
rs137852757, rs80356682, rs80356680, rs786205094, rs121912482, rs786205095, rs587776813, rs121912487, rs587776814, rs1558092501, rs80356683, rs118203899, rs118203900, rs1558095794, rs118203901, rs1558088792, rs121912466, rs2147483647, rs746056280, rs121912832, rs121912833, rs121912834, rs121912836, rs121912837, rs759990189, rs121912839, rs121912844, rs121912845, rs1575495784, rs121912848, rs121912849, rs121912851, rs121912852, rs121912853, rs121912854, rs121912855, rs121912769, rs1564673127, rs121912770, rs753898533, rs121912771, rs1589562891, rs2134563935, rs2134581672, rs121912772, rs121912773, rs121912774, rs121912856, rs201551805, rs769967565, rs786204774, rs797045084, rs886039330, rs886039412, rs1553277702, rs886041187, rs368007918, rs886041186, rs766902987, rs886041555, rs752657203, rs757415879, rs886058642, rs752317971, rs201307156, rs1057517096, rs774133746, rs772421306, rs758886532, rs144023803, rs1057517723, rs760063197, rs916512411, rs772381373, rs768128088, rs374718902, rs762162799, rs1064793916, rs780623622, rs747522386, rs1064793760, rs775196743, rs1131691385, rs201940939, rs200972872, rs139318843, rs1368134215, rs1203706188, rs772038362, rs1553281335, rs1181742615, rs1553853022, rs1553612928, rs1055680335, rs1057517023, rs760094345, rs1560241522, rs199527325, rs751535193, rs767539005, rs775244527, rs769808745, rs1032335328, rs1478395810, rs777672897, rs1575466699, rs776841521, rs1589572214, rs761388039, rs769294243, rs761927109, rs754621187 |
18348258, 7545057, 11328943, 11251584, 10873890, 9546354, 18348258, 10484780, 7545057, 9892956, 10792571, 9422533, 9792864, 12485428 |
Epidermolysis bullosa simplex |
Epidermolysis Bullosa Simplex, Epidermolysis bullosa simplex, Ogna type, Weber-Cockayne Syndrome |
rs1565118389, rs121918354, rs1558193923, rs786205251, rs786205253, rs786205254, rs80338756, rs864309671, rs137853160, rs864309672, rs137853161, rs59629244, rs60399023, rs58330629, rs57121345, rs60725382, rs61371557, rs28928893, rs57358989, rs58380626, rs57364972, rs58762773, rs60171927, rs57599352, rs58058996, rs58072617, rs58163069, rs60586163, rs121912474, rs57499817, rs60715293, rs121912475, rs57348201, rs61126080, rs59115483, rs59190510, rs864309674, rs387906801, rs387906802, rs201045495, rs267607458, rs59243757, rs62642056, rs56922686, rs267607456, rs267607457, rs59840738, rs57142010, rs61297109, rs56974573, rs61536893, rs58393329, rs61664582, rs267607389, rs59442925, rs58357841, rs57278315, rs60338701, rs61263401, rs60470268, rs61027685, rs200779504, rs267607406, rs58560979, rs60090257, rs60231560, rs374419983, rs886037957, rs886037956, rs749309384, rs1057515580, rs1555156076, rs1553275192, rs1565593355, rs1571564381, rs1571557821 |
10484780, 12485428 |
Glomerulonephritis |
Glomerulonephritis |
rs778043831 |
|
Hypohidrotic ectodermal dysplasia |
Anhydrotic Ectodermal Dysplasias |
rs104894415, rs28937872, rs104894416 |
18348258 |
Junctional epidermolysis bullosa |
Junctional Epidermolysis Bullosa, Adult junctional epidermolysis bullosa (disorder), Intermediate generalized junctional epidermolysis bullosa |
rs80356682, rs121912482, rs786205095, rs769151482, rs118203901, rs121912467, rs121912468, rs121912769, rs80356681, rs370148688, rs770302956, rs778012079, rs201307156, rs1057516759, rs1057517096, rs1057516539, rs774133746, rs754289857, rs1064793896, rs775196743, rs747916314, rs759518184, rs1554848576, rs1210666598, rs1553266871, rs1418276828, rs1158945258, rs775244527, rs1558092158, rs1571803654, rs774734592, rs778026407 |
7545057, 10484780, 10792571, 12485428 |
Junctional epidermolysis bullosa gravis of herlitz |
Herlitz Disease |
rs137852757, rs80356682, rs80356680, rs121912483, rs121912484, rs121912485, rs769151482, rs1558092501, rs80356683, rs118203899, rs80356681, rs80356679, rs80356678, rs151190720, rs767847211, rs753268823, rs146794392, rs201551805, rs769967565, rs776537364, rs371267954, rs786204732, rs886041893, rs1553277702, rs886045870, rs763559509, rs771613805, rs1057516806, rs1057517353, rs759509443, rs1057516410, rs745512079, rs1057516444, rs757617349, rs1057516218, rs774080932, rs1057516487, rs1057516569, rs778012079, rs776142807, rs1057516383, rs1057516727, rs1057516935, rs1057517159, rs1057516473, rs201307156, rs1057516400, rs1057516759, rs1057516756, rs777292177, rs1057516838, rs1057516486, rs1057517207, rs1057516822, rs1057516219, rs1057517096, rs1057517290, rs1057516316, rs1057517395, rs1057516249, rs1057516809, rs1057516539, rs1057516693, rs370148688, rs1057516947, rs1057516399, rs1057516241, rs1057517258, rs1057516675, rs1057517312, rs1057516884, rs1057516512, rs752030611, rs1057517023, rs1057516475, rs1057517235, rs1057517367, rs1057517314, rs1057516584, rs1057516688, rs1057516280, rs1057516476, rs1057517196, rs1057516279, rs1057516605, rs774133746, rs1057516764, rs1057517211, rs1057517272, rs1057517440, rs772421306, rs747916314, rs772038362, rs759518184, rs1553277267, rs1553265770, rs1553266052, rs1553266671, rs1553267345, rs1553267554, rs1553267679, rs1553267885, rs1178041263, rs1553279044, rs1553279073, rs1553265902, rs1479808203, rs1553266260, rs1553264644, rs1553266433, rs1553267638, rs1553265794, rs1553267882, rs1043996591, rs1553266537, rs774472247, rs1553267007, rs1553276216, rs1553266871, rs1553267356, rs1553267060, rs1553276430, rs1418276828, rs1553267499, rs1375506940, rs1186161867, rs1553277072, rs1553267870, rs1553275219, rs753711190, rs1553276110, rs1553276268, rs1464038626, rs1553281291, rs1553276488, rs1553277432, rs1553277686, rs778372285, rs1555724066, rs1555728701, rs747547191, rs1231716161, rs1555724108, rs1555728297, rs1555731178, rs1158945258, rs1555732431, rs1555730209, rs1555734356, rs1555737509, rs1555732032, rs765104557, rs1303193834, rs1555735252, rs1555736532, rs1555740963, rs754558574, rs1401574168, rs1555746079, rs1555736608, rs1555737629, rs1555740945, rs1555744812, rs1555754655, rs1555751482, rs1555721815, rs1555732528, rs1555737473, rs1555737779, rs1356353167, rs768415785, rs1555740717, rs1555745207, rs1555745317, rs1555754450, rs1234435123, rs1555720521, rs900100444, rs1555728319, rs1555732939, rs1555734513, rs141789403, rs1555743454, rs1555743457, rs1555744805, rs1555745263, rs34754160, rs1555751423, rs1555751529, rs1296034886, rs777672897, rs1571796718 |
7545057 |
Junctional epidermolysis bullosa with pyloric atresia |
Junctional epidermolysis bullosa with pyloric atresia |
rs794726676, rs121912461, rs121912462, rs80338755, rs121912463, rs147222357, rs121912464, rs121912465, rs1434530468, rs121912467, rs121912468, rs758551913, rs879255260, rs886041205, rs752657203, rs772142634, rs551348450, rs545619665 |
|
Lung carcinoma |
Non-Small Cell Lung Carcinoma |
rs1805076, rs121909071, rs121913530, rs112445441, rs121913529, rs121913535, rs121913297, rs121913279, rs104886003, rs397516975, rs11554290, rs121913364, rs121913351, rs121913369, rs121913355, rs121912470, rs121913273, rs121913281, rs121913348, rs727503093, rs121913353, rs397516890, rs397516896, rs121913378, rs397516897, rs397516977, rs397516978, rs397516979, rs397516980, rs397516981, rs397516982, rs121913240, rs17851045, rs397517086, rs121913428, rs397517094, rs397517098, rs397517106, rs121913465, rs397517108, rs397517111, rs397517112, rs397517114, rs397517116, rs1554350366, rs397517127, rs397517200, rs397517202, rs121913283, rs121913370, rs121913357, rs727503106, rs121913238, rs727503108, rs397517040, rs397516976, rs1555618025, rs1057519729, rs1584238193 |
27107458 |
Palmoplantar keratoderma |
Keratoderma, Palmoplantar |
rs59616921, rs1568039793, rs746488412, rs200564757, rs1567027297, rs781596375, rs1567027610, rs398123054, rs398123055, rs398123056, rs398123057, rs398122949, rs398122950, rs397515639, rs398122951, rs397515640, rs397515641, rs142859678, rs797044479, rs577442939, rs672601344, rs568609861, rs1057518846, rs1182196436, rs1567037561 |
|
Renal dysplasia |
Renal Cell Dysplasia, Renal dysplasia |
rs387907123 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Accessory kidney |
Accessory kidney |
|
|
Congenital pyloric atresia |
Congenital pyloric atresia |
|
|
Cystitis |
Cystitis |
|
|
Dental enamel hypoplasia |
Dental Enamel Hypoplasia |
|
|
Dysphagia |
Deglutition Disorders |
|
|
Ectropion |
Ectropion |
|
|
Epidermolysis bullosa simplex with pyloric atresia |
Epidermolysis Bullosa Simplex With Pyloric Atresia |
|
|
Esophageal atresia |
Esophageal Atresia |
|
|
Glomerulosclerosis |
Glomerulosclerosis (disorder) |
|
|
Hidrotic ectodermal dysplasia |
Hidrotic Ectodermal Dysplasia |
|
18348258 |
Hydronephrosis |
Hydronephrosis |
|
|
Hypodontia |
Hypodontia |
|
|
Intestinal atresia |
Intestinal Atresia |
|
|
Junctional split |
Junctional split |
|
|
Miscarriage |
Miscarriage |
|
18539642 |
Nail diseases |
NAIL DISORDER, NONSYNDROMIC CONGENITAL, 9 |
|
|
Nail dysplasia |
Nail dysplasia |
|
|
Nail dystrophy |
Dystrophia unguium |
|
|
Pterygium |
Pterygium |
|
|
Pyloric atresia |
Pyloric Atresia |
|
7545057, 18348258 |
Salivary gland neoplasm |
Salivary Gland Neoplasms |
|
16762588 |
Malignant neoplasm of salivary gland |
Malignant neoplasm of salivary gland |
|
16762588 |
Skin erosion |
Skin Erosion |
|
|
Ureterocele |
Ureterocele |
|
|
Urogenital abnormalities |
Urogenital Abnormalities |
|
|
|
|
|