IGSF1 (immunoglobulin superfamily member 1)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
3547 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Immunoglobulin superfamily member 1 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
IGSF1 |
SynonymsGene synonyms aliases
|
CHTE, IGCD1, IGDC1, INHBP, PGSF2, p120 |
ChromosomeChromosome number
|
X |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
Xq26.1 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene encodes a member of the immunoglobulin-like domain-containing superfamily. Proteins in this superfamily contain varying numbers of immunoglobulin-like domains and are thought to participate in the regulation of interactions between cells. Multip |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs397514622 |
G>A,C |
Pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant |
rs398122919 |
C>T |
Pathogenic |
Genic downstream transcript variant, stop gained, intron variant, coding sequence variant |
rs398122920 |
C>- |
Pathogenic |
Genic downstream transcript variant, frameshift variant, coding sequence variant |
rs398122921 |
->A |
Pathogenic |
Genic downstream transcript variant, frameshift variant, coding sequence variant |
rs1293658262 |
G>A |
Likely-pathogenic |
Genic downstream transcript variant, coding sequence variant, stop gained |
rs1556177186 |
C>- |
Pathogenic |
Genic downstream transcript variant, coding sequence variant, splice donor variant |
rs1556181091 |
TTATACAGAGCAAACCCCATGCCTGCC>- |
Pathogenic |
Genic downstream transcript variant, inframe deletion, coding sequence variant |
rs1603404297 |
->G |
Pathogenic |
Coding sequence variant, frameshift variant, genic downstream transcript variant |
rs1603404413 |
A>G |
Pathogenic |
Coding sequence variant, missense variant, genic downstream transcript variant |
rs1603404421 |
->T |
Pathogenic |
Coding sequence variant, frameshift variant, genic downstream transcript variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
Q8N6C5 |
Protein name |
Immunoglobulin superfamily member 1 (IgSF1) (Immunoglobulin-like domain-containing protein 1) (Inhibin-binding protein) (InhBP) (Pituitary gland-specific factor 2) (p120) |
Protein function |
Seems to be a coreceptor in inhibin signaling, but seems not to be a high-affinity inhibin receptor. Antagonizes activin A signaling in the presence or absence of inhibin B (By similarity). Necessary to mediate a specific antagonistic effect of |
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF13895 |
Ig_2 |
37 → 125 |
Immunoglobulin domain |
Domain |
PF13895 |
Ig_2 |
322 → 414 |
Immunoglobulin domain |
Domain |
PF13895 |
Ig_2 |
780 → 868 |
Immunoglobulin domain |
Domain |
PF13895 |
Ig_2 |
874 → 962 |
Immunoglobulin domain |
Domain |
PF13895 |
Ig_2 |
970 → 1060 |
Immunoglobulin domain |
Domain |
PF00047 |
ig |
1070 → 1137 |
Immunoglobulin domain |
Domain |
PF13895 |
Ig_2 |
1162 → 1247 |
Immunoglobulin domain |
Domain |
|
Sequence |
|
Sequence length |
1336 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Central congenital hypothyroidism with testicular enlargement, x-linked |
X-linked central congenital hypothyroidism with late-onset testicular enlargement |
rs1556181091, rs398122919, rs398122920, rs397514622, rs398122921, rs1603404421, rs1603404413, rs1603404297 |
|
Congenital hypothyroidism |
Congenital Hypothyroidism |
rs121909180, rs121912646, rs121912648, rs1587178555, rs530719719, rs189261858, rs567500345, rs560702757, rs374620255, rs774517670 |
23143598 |
Hypothyroidism |
Hypothyroidism |
rs869320723, rs121908862, rs121908863, rs121908865, rs121908866, rs121908867, rs121908870, rs121908871, rs121908872, rs2140110277, rs121908881, rs121908884, rs121908885, rs786205080, rs1586182912, rs121917847, rs104893655, rs104893657, rs104893658, rs104893659, rs104893660, rs104893656, rs121917719, rs786204790, rs189261858, rs879255608, rs868197660, rs879255609, rs1586744173, rs1586182837, rs771222349, rs1587618417, rs1601844140, rs760832986, rs780982673, rs1603336347, rs1691155605 |
|
Isolated somatotropin deficiency |
Isolated somatotropin deficiency |
rs797044450, rs71640277, rs863223306, rs2144738731, rs863223307, rs2144739370, rs863223309, rs863223310, rs137853223, rs2144739380, rs2144739391 |
24108313 |
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Central hypothyroidism |
Central hypothyroidism |
|
24108313 |
Congenital myxedema |
Myxedema, Congenital |
|
23143598 |
Endemic cretinism |
Endemic Cretinism |
|
23143598 |
Hypothyroidism, central, and testicular enlargement |
HYPOTHYROIDISM, CENTRAL, AND TESTICULAR ENLARGEMENT |
|
23143598, 26302767, 24108313 |
Testicular diseases |
Testicular Diseases |
|
23143598 |
|
|
|
| © 2021, Biomedical Informatics Centre, NIRRH |
ICMR-National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400012
Tel: +91-22-24192104, Fax No: +91-22-24139412 |