Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
3239 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Homeobox D13 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
HOXD13 |
SynonymsGene synonyms aliases
|
BDE, BDSD, HOX4I, SPD, SPD1 |
ChromosomeChromosome number
|
2 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
2q31.1 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene cluster |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs28928891 |
A>C,G |
Pathogenic |
Coding sequence variant, genic downstream transcript variant, missense variant |
rs28928892 |
C>A,G |
Pathogenic |
Coding sequence variant, genic downstream transcript variant, missense variant |
rs28933082 |
C>G,T |
Pathogenic |
Coding sequence variant, genic downstream transcript variant, missense variant |
rs104893635 |
A>G |
Pathogenic |
Coding sequence variant, missense variant, genic downstream transcript variant |
rs121912541 |
G>A,C,T |
Pathogenic |
Intron variant, missense variant, coding sequence variant, genic downstream transcript variant |
rs200750564 |
C>T |
Likely-pathogenic, pathogenic, uncertain-significance |
Coding sequence variant, genic downstream transcript variant, stop gained |
rs536639583 |
G>C |
Pathogenic, uncertain-significance |
Intron variant, downstream transcript variant, missense variant, coding sequence variant, genic downstream transcript variant |
rs749985629 |
CAA>- |
Likely-pathogenic |
Genic downstream transcript variant, inframe deletion, coding sequence variant |
rs764838478 |
A>- |
Pathogenic |
Splice acceptor variant, genic downstream transcript variant |
rs875989842 |
C>A |
Pathogenic |
Coding sequence variant, missense variant, genic downstream transcript variant |
rs878854343 |
CAGCACCCACGCCT>- |
Pathogenic |
Genic downstream transcript variant, frameshift variant, coding sequence variant, intron variant |
rs878854344 |
G>- |
Pathogenic |
Frameshift variant, coding sequence variant, genic downstream transcript variant |
rs878854345 |
->GGCTGCGGCGGCGGCAGCGGC |
Pathogenic |
Genic downstream transcript variant, coding sequence variant, inframe insertion, intron variant |
rs878854346 |
AGCGGCGGCTGCGGCGGCGGC>-,AGCGGCGGCTGCGGCGGCGGCAGCGGCGGCTGCGGCGGCGGC |
Pathogenic |
Coding sequence variant, intron variant, genic downstream transcript variant, inframe insertion, inframe deletion |
rs878854400 |
C>T |
Pathogenic |
Genic downstream transcript variant, coding sequence variant, stop gained, intron variant |
rs879255265 |
G>A |
Pathogenic |
Coding sequence variant, missense variant, genic downstream transcript variant |
rs886037831 |
G>A |
Pathogenic |
Splice donor variant, genic downstream transcript variant, intron variant |
rs1574943406 |
GCCA>- |
Pathogenic |
Frameshift variant, genic downstream transcript variant, intron variant, coding sequence variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
GO ID |
Ontology |
Definition |
Evidence |
Reference |
GO:0000785 |
Component |
Chromatin |
ISA |
|
GO:0000978 |
Function |
RNA polymerase II cis-regulatory region sequence-specific DNA binding |
IBA |
21873635 |
GO:0000981 |
Function |
DNA-binding transcription factor activity, RNA polymerase II-specific |
IBA |
21873635 |
GO:0000981 |
Function |
DNA-binding transcription factor activity, RNA polymerase II-specific |
ISA |
|
GO:0001228 |
Function |
DNA-binding transcription activator activity, RNA polymerase II-specific |
IMP |
24789103 |
GO:0001501 |
Process |
Skeletal system development |
IEA |
|
GO:0003677 |
Function |
DNA binding |
IDA |
26581570 |
GO:0003682 |
Function |
Chromatin binding |
IEA |
|
GO:0003700 |
Function |
DNA-binding transcription factor activity |
ISS |
|
GO:0005654 |
Component |
Nucleoplasm |
IDA |
|
GO:0006355 |
Process |
Regulation of transcription, DNA-templated |
TAS |
9207113 |
GO:0006357 |
Process |
Regulation of transcription by RNA polymerase II |
IBA |
21873635 |
GO:0007275 |
Process |
Multicellular organism development |
TAS |
9207113 |
GO:0009952 |
Process |
Anterior/posterior pattern specification |
IEA |
|
GO:0030539 |
Process |
Male genitalia development |
IEA |
|
GO:0033574 |
Process |
Response to testosterone |
IEA |
|
GO:0042127 |
Process |
Regulation of cell population proliferation |
IEA |
|
GO:0042733 |
Process |
Embryonic digit morphogenesis |
IEA |
|
GO:0045944 |
Process |
Positive regulation of transcription by RNA polymerase II |
IMP |
24789103 |
GO:0048619 |
Process |
Embryonic hindgut morphogenesis |
IEA |
|
GO:0060527 |
Process |
Prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis |
IEA |
|
GO:0060571 |
Process |
Morphogenesis of an epithelial fold |
IEA |
|
GO:0060602 |
Process |
Branch elongation of an epithelium |
IEA |
|
GO:0060687 |
Process |
Regulation of branching involved in prostate gland morphogenesis |
IEA |
|
GO:1990837 |
Function |
Sequence-specific double-stranded DNA binding |
IDA |
28473536 |
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P35453 |
Protein name |
Homeobox protein Hox-D13 (Homeobox protein Hox-4I) |
Protein function |
Sequence-specific transcription factor that binds gene promoters and activates their transcription (PubMed:24789103). Part of a developmental regulatory system that provides cells with specific positional identities on the anterior-posterior axi |
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF12284 |
HoxA13_N |
79 → 181 |
Hox protein A13 N terminal |
Family |
PF00046 |
Homeodomain |
277 → 333 |
Homeodomain |
Domain |
|
Sequence |
|
Sequence length |
343 |
Interactions |
View interactions |
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Anemia |
Anemia |
rs118204044, rs118204045, rs118204046, rs121918330, rs869320719, rs869312029, rs121918332, rs869320724, rs767094129, rs786205058, rs786205059, rs137853119, rs137853120, rs137853121, rs1384933966, rs137853122, rs137853123, rs786205060, rs267607121, rs121908584, rs80338697, rs80338699, rs120074166, rs120074167, rs1050828, rs74575103, rs137852314, rs5030868, rs137852316, rs137852317, rs137852318, rs137852319, rs137852320, rs137852321, rs137852322, rs137852323, rs137852324, rs72554665, rs387906468, rs5030872, rs137852326, rs137852333, rs137852327, rs137852328, rs137852329, rs137852330, rs137852331, rs137852332, rs137852334, rs137852335, rs137852336, rs137852339, rs76645461, rs137852340, rs137852341, rs78478128, rs137852343, rs137852344, rs137852345, rs587776730, rs137852346, rs137852347, rs137852349, rs2070404412, rs2070350038, rs2070350009, rs137852303, rs137852304, rs33946267, rs34378160, rs33933298, rs11549407, rs35724775, rs34598529, rs41469945, rs267607201, rs80338694, rs80338696, rs387907018, rs398123546, rs78365220, rs587777100, rs587777101, rs483352840, rs869312752, rs765487627, rs1557229599, rs1557230040, rs1555524842, rs782090947, rs1358275550, rs1557229736, rs1557230573, rs1556323334, rs1233124208, rs1293528130, rs146864395, rs1595503440, rs1603411214, rs137852325, rs1575247302, rs1603411177, rs1336651679, rs782322505 |
27725143 |
Anencephaly |
Anencephaly |
rs773607884 |
|
Brachydactyly |
BRACHYDACTYLY, TYPE D, Brachydactyly, Brachydactyly syndrome type E, Brachydactyly type E, NON RARE IN EUROPE: Brachydactyly type D |
rs121908949, rs28937580, rs121909082, rs104894122, rs863223289, rs863223290, rs104894121, rs1587657302, rs863223292, rs74315386, rs74315387, rs28936397, rs753691079, rs121909348, rs121917852, rs121917853, rs121917854, rs121917855, rs121917859, rs121917861, rs267606873, rs267606872, rs267606985, rs267606986, rs267606987, rs267606988, rs28933082, rs397514519, rs869025613, rs869025614, rs886039878, rs1553540620, rs1057518333, rs1948841937, rs1948868228, rs1948842030, rs1948842142 |
24239177, 12649808, 17236141, 12649808 |
Brachydactyly-syndactyly syndrome |
BRACHYDACTYLY-SYNDACTYLY SYNDROME, Brachydactyly-syndactyly, Zhao type |
rs878854346, rs200750564 |
24239177, 23995701, 17236141, 12649808 |
Brachydactyly-syndactyly-oligodactyly syndrome |
BRACHYDACTYLY-SYNDACTYLY-OLIGODACTYLY SYNDROME |
rs875989842 |
17236141 |
Congenital diaphragmatic hernia |
Congenital diaphragmatic hernia |
rs121908602, rs121908604, rs864309713, rs780263938, rs756636036, rs775394591 |
|
Cryptorchidism |
Cryptorchidism |
rs121912555, rs104894697, rs104894698, rs398122886 |
|
Macrocephaly |
Macrocephaly |
rs786204854, rs764333096, rs1557739557 |
|
Neutropenia |
Neutropenia |
rs879253882 |
27725143 |
Oligospermia |
Oligospermia |
rs1602125411, rs2047796277, rs377712900 |
|
Polydactyly |
Polydactyly, Polydactyly preaxial type 1 |
rs1583729398, rs121917709, rs1583734240, rs121917714, rs397507422, rs398122899, rs587776959, rs386833752, rs1057518698, rs1060499558, rs755938967, rs1375768446, rs1309855392, rs1565601979, rs748321474, rs368652620, rs1562587032, rs760694987 |
17236141 |
Polysyndactyly |
Polysyndactyly |
rs1583729562, rs121917713 |
|
Rheumatoid arthritis |
Rheumatoid Arthritis |
rs3766379, rs3792876, rs2071592, rs3087456, rs587776843, rs1566328963, rs2240340, rs1557787212 |
17568789 |
Syndactyly |
Syndactyly, Syndactyly, type v, Syndactyly, type 2 |
rs878854345, rs104893635, rs28931600, rs587777050, rs587777051, rs606231304 |
17236141, 12649808, 24239177, 26581570, 24789103, 12649808, 8817328, 24239177, 16222680, 22448207, 12414828, 17236141 |
Synpolydactyly |
Synpolydactyly type 1 |
rs878854343, rs878854344, rs764838478, rs28933082, rs878854345, rs121912541, rs878854400, rs879255265, rs886037831, rs200750564 |
|
Vacterl association |
VACTERL Association, VACTERL/VATER association, VATER Association, VATER/VACTERL ASSOCIATION |
rs752504125, rs869320684, rs776556963 |
19006232, 12649808 |
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Abnormal spinal segmentation |
Defect of vertebral segmentation |
|
|
Ambiguous genitalia |
Ambiguous Genitalia |
rs782562963 |
|
Camptodactyly of fingers |
Clinodactyly of the 5th finger |
|
|
Carpal synostosis |
Carpal synostosis |
|
|
Congenital anomaly of limb |
Limb Deformities, Congenital |
|
8620844 |
Congenital camptodactyly |
Congenital Camptodactyly |
|
|
Short clavicles |
Congenital hypoplasia of clavicle |
|
|
Congenital hypoplasia of penis |
Congenital hypoplasia of penis |
|
|
Congenital omphalocele |
Congenital omphalocele |
|
|
Dwarfism |
Dwarfism |
|
|
Ectopic kidney |
Ectopic kidney |
|
|
Foot polydactyly |
Postaxial foot polydactyly |
|
|
Frontal bossing |
Frontal bossing |
|
|
Congenital gallbladder anomaly |
Gallbladder anomaly congenital |
|
|
Heart septal defects |
Heart Septal Defects |
|
|
Hemangioma, cavernous |
Hemangioma, Cavernous |
|
|
Hydronephrosis |
Hydronephrosis |
|
|
Hypospadias |
Hypospadias |
|
|
Imperforate anus |
Anus, Imperforate |
|
|
Laryngomalacia |
Laryngomalacia |
|
|
Lymphopenia |
Lymphopenia |
|
27725143 |
Multicystic renal dysplasia |
Multicystic Dysplastic Kidney |
|
|
Occipital encephalocele |
Occipital Encephalocele |
|
|
Oligodactyly |
Oligodactyly |
|
|
Penile hypospadias |
Penile hypospadias |
|
|
Renal agenesis |
Congenital absence of kidneys syndrome |
|
|
Syndactyly of fingers |
Syndactyly of fingers, Cutaneous finger syndactyly |
|
|
Syndactyly of the toes |
Syndactyly of the toes, 2-3 toe syndactyly |
|
|
Tracheal stenosis |
Tracheal Stenosis |
|
|
Zygodactyly |
Zygodactyly type 3 |
|
|
|
|
|