GYS2 (glycogen synthase 2)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
2998 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Glycogen synthase 2 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
GYS2 |
SynonymsGene synonyms aliases
|
- |
ChromosomeChromosome number
|
12 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
12p12.1 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
The protein encoded by this gene, liver glycogen synthase, catalyzes the rate-limiting step in the synthesis of glycogen - the transfer of a glucose molecule from UDP-glucose to a terminal branch of the glycogen molecule. Mutations in this gene cause glyc |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs117639846 |
C>G |
Conflicting-interpretations-of-pathogenicity, benign |
Coding sequence variant, genic downstream transcript variant, missense variant |
rs121918419 |
G>A |
Pathogenic, likely-pathogenic |
Coding sequence variant, stop gained |
rs121918421 |
C>G |
Pathogenic |
Coding sequence variant, missense variant |
rs121918423 |
T>C |
Pathogenic |
Genic upstream transcript variant, coding sequence variant, missense variant |
rs121918424 |
A>G |
Pathogenic |
Coding sequence variant, genic downstream transcript variant, missense variant |
rs121918425 |
G>C,T |
Pathogenic |
Coding sequence variant, genic downstream transcript variant, missense variant |
rs146195866 |
G>A,T |
Pathogenic |
Synonymous variant, stop gained, coding sequence variant |
rs150382575 |
G>A,T |
Pathogenic, likely-pathogenic |
Synonymous variant, stop gained, coding sequence variant |
rs201157731 |
G>A |
Pathogenic |
Stop gained, coding sequence variant |
rs267603422 |
G>A,C |
Pathogenic |
Missense variant, stop gained, coding sequence variant |
rs372079212 |
C>A |
Pathogenic |
Splice donor variant |
rs587776831 |
C>G,T |
Pathogenic |
Splice donor variant |
rs746120293 |
CACAGTATAGATGCCTCCAACTGTTAAA>- |
Pathogenic |
Coding sequence variant, genic upstream transcript variant, intron variant, upstream transcript variant, splice acceptor variant |
rs764539267 |
C>T |
Likely-pathogenic |
Downstream transcript variant, splice donor variant, genic downstream transcript variant |
rs766733439 |
C>T |
Likely-pathogenic |
Splice acceptor variant, genic downstream transcript variant |
rs771205749 |
T>- |
Pathogenic, likely-pathogenic |
Coding sequence variant, frameshift variant |
rs781511110 |
C>A |
Likely-pathogenic |
Splice donor variant |
rs863224039 |
A>G,T |
Likely-pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant |
rs1064793142 |
T>A |
Likely-pathogenic |
Missense variant, coding sequence variant, genic downstream transcript variant |
rs1064793143 |
A>C |
Likely-pathogenic |
Missense variant, coding sequence variant, genic downstream transcript variant |
rs1307281520 |
G>- |
Pathogenic |
Coding sequence variant, stop gained |
rs1555156695 |
AAGTCTTTTCAAGATCAAAGTCGAGATGACTAAAACAAAACAAAACCAAACAGTTTCAAATGAAATACAGCAACA>- |
Pathogenic |
Intron variant, coding sequence variant, splice acceptor variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P54840 |
Protein name |
Glycogen [starch] synthase, liver (EC 2.4.1.11) (Glycogen synthase 2) |
Protein function |
Glycogen synthase participates in the glycogen biosynthetic process along with glycogenin and glycogen branching enzyme. Extends the primer composed of a few glucose units formed by glycogenin by adding new glucose units to it. In this context, |
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF05693 |
Glycogen_syn |
32 → 667 |
Glycogen synthase |
Family |
|
Sequence |
|
Sequence length |
703 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Developmental delay |
Global developmental delay |
rs28941770, rs199469464, rs281865469, rs143747297, rs398123009, rs587777428, rs786205133, rs606231459, rs797044854, rs797045027, rs864309504, rs878853160, rs886039902, rs886042046, rs886041291, rs886041382, rs1057518991, rs1057518699, rs753254213, rs748294403, rs762552974, rs1135401795, rs1553121073, rs1553122926, rs1364690005, rs1554086554, rs1554210415, rs1554168326, rs1554776342, rs1553873247, rs1567860112, rs779009256, rs1557447255, rs1564568350, rs780011005, rs1597464953, rs1200336864, rs1569513017, rs1587459606, rs1570332505, rs748888652, rs1575155995, rs2087029320, rs1589669105, rs1601769604, rs1184981709, rs749201074 |
|
Glycogen storage disease |
Glycogen Storage Disease, Glycogen Storage Disease 0, Liver, Glycogen storage disease due to hepatic glycogen synthase deficiency |
rs10250779, rs387906244, rs113994126, rs113994129, rs113994134, rs369973784, rs199922945, rs118203964, rs113994132, rs387906246, rs113994128, rs267606639, rs267606640, rs755419857, rs895690691, rs121918193, rs121918195, rs121918196, rs116987552, rs119103251, rs119103252, rs119103253, rs119103254, rs144081869, rs119103255, rs786200874, rs267606993, rs119103257, rs119103258, rs119103259, rs119103260, rs1474863903, rs764313717, rs397515342, rs80338671, rs137852886, rs80338672, rs137852888, rs80338673, rs397515343, rs137852889, rs137852890, rs137852891, rs1575782181, rs137852892, rs397515344, rs137852894, rs121907936, rs121907937, rs28937909, rs121907938, rs121907940, rs121907941, rs386834236, rs121907939, rs28940868, rs1555603048, rs121907942, rs386834235, rs121907943, rs121907945, rs121908987, rs121908991, rs267606977, rs137852546, rs137852547, rs1603266754, rs137852548, rs137852528, rs137852529, rs431905501, rs137852531, rs137852532, rs137852533, rs137852535, rs137852536, rs137852537, rs137852538, rs431905503, rs137852539, rs137852285, rs137852286, rs587776731, rs137852287, rs137852288, rs587776732, rs137852293, rs137852289, rs137852290, rs137852291, rs137852292, rs137852294, rs587776733, rs2147483647, rs137852295, rs113993982, rs113993974, rs113993977, rs113993981, rs80356488, rs1801175, rs104894563, rs80356487, rs104894566, rs587776757, rs80356484, rs104894565, rs104894567, rs104894568, rs104894569, rs80356482, rs1801176, rs104894571, rs34667348, rs797044442, rs121918021, rs137853588, rs137853589, rs137853590, rs1596680941, rs137853591, rs137853592, rs118203895, rs118203896, rs118203897, rs267607212, rs121918419, rs587776831, rs121918420, rs121918421, rs121918422, rs121918423, rs121918424, rs121434584, rs80356485, rs80356479, rs80356483, rs113994130, rs113994131, rs113993978, rs113993979, rs113993986, rs113993973, rs113993975, rs387906505, rs113993976, rs199948078, rs193922697, rs397514631, rs1325298827, rs140869027, rs398123169, rs398123171, rs398123172, rs369532274, rs398123173, rs398123174, rs398124208, rs398124209, rs398124210, rs587777375, rs527236146, rs527236147, rs370652040, rs143137713, rs727502871, rs369531647, rs730880022, rs730880372, rs201958741, rs730882148, rs796051877, rs752921215, rs786204489, rs781580050, rs771961377, rs370792293, rs786204678, rs786204616, rs786204481, rs786204490, rs776977863, rs786204595, rs786204655, rs769960481, rs767739769, rs786204723, rs755117847, rs764920787, rs780226142, rs367727229, rs786204467, rs201185475, rs786204614, rs786204661, rs767882689, rs528367092, rs370950728, rs757700700, rs786204532, rs201896815, rs543300039, rs786204507, rs786204646, rs786204517, rs770610356, rs770276275, rs147804176, rs772883420, rs140826989, rs786204720, rs786204727, rs781088002, rs549029029, rs368438393, rs536906561, rs374143224, rs757111744, rs786204621, rs786204645, rs786204549, rs780321415, rs786204561, rs202143236, rs786204785, rs374470794, rs771427957, rs150547274, rs113994127, rs193186112, rs794727706, rs794729208, rs797045008, rs192044702, rs797044877, rs150382575, rs201157731, rs863224023, rs869312919, rs764622267, rs878855017, rs1800312, rs886039883, rs886041476, rs779556619, rs757617999, rs143523371, rs886042086, rs201201443, rs886042358, rs761317813, rs142752477, rs142967546, rs766074609, rs770590394, rs144016984, rs886043148, rs778032599, rs886043343, rs886043399, rs886043920, rs775450536, rs755253527, rs758004953, rs766935302, rs886058900, rs1057516189, rs1057516870, rs1057517057, rs1057516567, rs1057517347, rs1057517243, rs777857395, rs1057516868, rs757967016, rs1057516308, rs1057517344, rs1057516397, rs1057516471, rs748789700, rs763554006, rs1057516741, rs1057516948, rs1057516913, rs1057516570, rs1057516563, rs1057516708, rs1057516666, rs1057517136, rs1057517425, rs1057516984, rs1057516254, rs531425980, rs1057516793, rs1057516306, rs1057516952, rs1057516513, rs1057517079, rs764318570, rs1057517017, rs867341758, rs745757264, rs1057517405, rs1057516994, rs1057517315, rs1057516529, rs1057517001, rs1057517058, rs1057517067, rs1057516598, rs753181427, rs1057517442, rs747513238, rs752848974, rs1057516259, rs1057516612, rs749560316, rs1057516468, rs1057517400, rs752851284, rs1057516329, rs1057516629, rs1057517145, rs1057517361, rs1057516349, rs772194378, rs1057516367, rs1057517227, rs1057516674, rs1057517008, rs1057516630, rs749323139, rs1057516858, rs80356486, rs1055945806, rs1057516251, rs1057517165, rs1057516503, rs1057517381, rs1057517320, rs376229714, rs1057516600, rs762260678, rs1057516290, rs1057516785, rs1057516520, rs757458607, rs1057516546, rs1057517286, rs1057516215, rs560575383, rs747610090, rs892129065, rs1057517267, rs1057516426, rs377544304, rs1057516826, rs1057517105, rs753269119, rs778418246, rs1057516928, rs1057516581, rs1057516327, rs1057516328, rs1057516277, rs1057516363, rs777275355, rs1057516924, rs1057517148, rs1057516704, rs1057516341, rs763359208, rs1057518106, rs780883601, rs775685508, rs751952198, rs148842275, rs766733439, rs1064795728, rs1064795749, rs1064796703, rs1064794288, rs375470378, rs1064796706, rs1064797157, rs764567774, rs145166656, rs767409395, rs150911354, rs757681143, rs200483245, rs771069887, rs114073621, rs1553690406, rs774465102, rs758504480, rs143670942, rs1422043936, rs373517016, rs1553188832, rs771853367, rs1553185403, rs12118058, rs1553193463, rs370247862, rs1555602832, rs1555560204, rs1555603264, rs61736895, rs763016962, rs1556016365, rs1555601828, rs991082382, rs1555599713, rs1555136390, rs754134578, rs752002666, rs1553183220, rs1307281520, rs1479740763, rs1555989523, rs1555600102, rs142917638, rs1553185302, rs1553684545, rs1555601234, rs373345919, rs1553183359, rs1556014969, rs760589837, rs776733170, rs1553185474, rs1553186489, rs757987101, rs140095668, rs1188310172, rs1555467052, rs1555467557, rs748363083, rs763027848, rs1555600730, rs1555598796, rs1555988479, rs1556000892, rs1556007472, rs1556002344, rs764591009, rs769172044, rs1555328280, rs1354714214, rs1553183148, rs930434905, rs751112302, rs878959417, rs775498547, rs1443902661, rs1553192718, rs1293077915, rs1553193529, rs1553181400, rs1215043175, rs1553185418, rs1553185883, rs1553183178, rs1553186577, rs1553188559, rs750492389, rs1553188849, rs1432024176, rs1289339080, rs767346840, rs1553190751, rs1553184620, rs755747010, rs1553193486, rs1553184657, rs1327892944, rs1553187237, rs1553185905, rs1553193530, rs1553186613, rs1553187957, rs773095419, rs1553189468, rs1185321132, rs770438130, rs1553190316, rs1555133248, rs1462767117, rs1555136752, rs1163710370, rs1555136208, rs1555136540, rs750857876, rs1555136459, rs187131358, rs1555559741, rs1411037881, rs1485038937, rs1555598687, rs1555598880, rs1555599171, rs1555599586, rs1555599637, rs1555598869, rs1555599644, rs1555599594, rs1555599619, rs1555600050, rs1555599960, rs766680292, rs1555600166, rs996798292, rs1555600575, rs770780848, rs1555601780, rs765362308, rs1209887739, rs1555603216, rs1428358278, rs776948121, rs1555601662, rs1555603131, rs192679574, rs1555559279, rs1189630738, rs1555559991, rs1555560140, rs1555560185, rs1555598460, rs1555598544, rs1555598824, rs1555600111, rs778068209, rs1555600846, rs747150965, rs753505203, rs914396317, rs1555602692, rs1344266804, rs1555558920, rs1457925404, rs1555598800, rs1207988953, rs1555599667, rs1555600061, rs1434761678, rs759518659, rs1555601802, rs1555602703, rs1555602860, rs1555603434, rs1555995635, rs1567825175, rs1567705064, rs1567838823, rs1559637815, rs1557794150, rs756175624, rs146195866, rs781511110, rs759657964, rs1563131309, rs746120293, rs746348793, rs770037766, rs1270523244, rs1567706564, rs1567260747, rs201056962, rs764539267, rs765718882, rs1568619900, rs1569298646, rs1569344469, rs1567828977, rs561646250, rs1569297379, rs1210626722, rs1569300538, rs1256371424, rs747947171, rs1565538121, rs1565536363, rs1569297427, rs1567830317, rs764750389, rs1555603219, rs1567829962, rs1430517061, rs1205507761, rs149244943, rs748262135, rs1556299510, rs780246932, rs752961445, rs1315020035, rs767095759, rs756205397, rs149096315, rs1242540921, rs371296953, rs1303617854, rs766536350, rs1414146587, rs1567835775, rs1567835781, rs1570433472, rs1570508240, rs763216519, rs1598585402, rs1598578030, rs1598581682, rs1592412131, rs1571232214, rs1571232404, rs1571243699, rs1570433686, rs1570438459, rs765367405, rs1206517501, rs1239498701, rs774926455, rs1480850606, rs777589783, rs768604948, rs1592410003, rs1592818641, rs760187622, rs539898848, rs755612674, rs1597988331, rs775826449, rs1232001857, rs200210219, rs1598575231, rs141533320, rs1598582021, rs764670084, rs1448515860, rs886043882, rs1601685358, rs1601689006, rs1601739229, rs1601781024, rs1601781031, rs539203557, rs1212333772, rs372079212, rs765425704, rs776545903, rs1597989985, rs1598592604, rs1597989983, rs1556257317, rs1475559733, rs1598577666, rs1598580364, rs1596687577, rs1372753669, rs1601714299, rs1601747985, rs1601776276, rs1601760689, rs1601763099, rs1571232325, rs1570445130, rs370202718, rs1570487381, rs1576183537, rs1592408302, rs1592409633, rs150483902, rs1596687555, rs762089284, rs1597990895, rs1597990906, rs1597991608, rs1597991733, rs1601687244, rs1601748216, rs1601776523, rs1571243862, rs1592409631, rs1601780766, rs2039275157, rs2039287628, rs1567702823, rs756632286, rs1597990921, rs1576137368, rs1322527832, rs1596047883, rs1650040391, rs780694207, rs758182700, rs1652018859, rs1652879873, rs1654912428, rs1703086906, rs781198373, rs1703800818, rs1490328834, rs1804721948, rs1311913891, rs2058363627, rs1005687078, rs2058388882, rs2058407169, rs2058421657, rs138893744, rs758943884, rs2056023296, rs1401928680, rs764401169, rs2056091436, rs915675670, rs2039038743, rs2039117815, rs2039190879, rs2039192386, rs2039213824, rs766398206, rs2039287852, rs2047467477, rs2047492649, rs2047492720, rs765360653, rs111911126, rs1219299972, rs2047834385, rs2039261208, rs1262967083, rs2047514376, rs2048391185, rs2058357329, rs1598580407, rs2039250790, rs755305465, rs766448695 |
20051115, 27604308, 9691087, 9691087, 12072888, 27604308, 20051115, 25070466, 28245189 |
Hyperlipidemia |
Hyperlipidemia |
rs118204057, rs118204060, rs118204062, rs1563569634, rs118204069, rs118204070, rs118204071, rs3737787, rs2073658, rs1566946168, rs1064797075 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Dwarfism |
Dwarfism |
|
|
Ketonuria |
Ketonuria |
|
|
Ketosis |
Ketosis |
|
|
Liver carcinoma |
Liver carcinoma |
|
28284560 |
Hypoglycemia |
Neonatal hypoglycemia |
|
|
|
|
|