Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
2896 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Granulin precursor |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
GRN |
SynonymsGene synonyms aliases
|
CLN11, FTD2, GEP, GP88, PCDGF, PEPI, PGRN |
ChromosomeChromosome number
|
17 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
17q21.31 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
Granulins are a family of secreted, glycosylated peptides that are cleaved from a single precursor protein with 7.5 repeats of a highly conserved 12-cysteine granulin/epithelin motif. The 88 kDa precursor protein, progranulin, is also called proepithelin |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs63749801 |
CAGT>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs63749817 |
G>A,C |
Likely-pathogenic, pathogenic, not-provided |
Splice donor variant |
rs63749877 |
CACT>- |
Pathogenic, not-provided |
Frameshift variant, coding sequence variant |
rs63749905 |
->A |
Pathogenic, not-provided |
Frameshift variant, coding sequence variant |
rs63749908 |
C>T |
Pathogenic, not-provided |
Stop gained, coding sequence variant |
rs63750077 |
C>T |
Pathogenic, not-provided |
Stop gained, coding sequence variant |
rs63750331 |
G>A |
Pathogenic, not-provided |
Initiator codon variant, missense variant |
rs63750411 |
C>T |
Pathogenic |
Stop gained, coding sequence variant |
rs63750412 |
C>T |
Conflicting-interpretations-of-pathogenicity, likely-benign, benign |
Missense variant, coding sequence variant |
rs63750548 |
A>G |
Pathogenic, not-provided |
Splice acceptor variant |
rs63750707 |
G>A |
Likely-pathogenic, not-provided |
Splice donor variant |
rs63751006 |
T>C |
Pathogenic, not-provided |
Initiator codon variant, missense variant |
rs63751020 |
A>G,T |
Likely-pathogenic, not-provided |
Intron variant, 5 prime UTR variant, upstream transcript variant, genic upstream transcript variant |
rs63751035 |
TG>-,TGTG |
Pathogenic, not-provided |
Stop gained, inframe indel, frameshift variant, coding sequence variant |
rs63751073 |
C>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs63751074 |
C>T |
Conflicting-interpretations-of-pathogenicity |
Synonymous variant, coding sequence variant |
rs63751085 |
CA>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs63751100 |
G>A |
Conflicting-interpretations-of-pathogenicity, uncertain-significance |
Missense variant, coding sequence variant |
rs63751166 |
G>A |
Pathogenic, not-provided |
Synonymous variant, coding sequence variant |
rs63751177 |
G>A |
Pathogenic |
Stop gained, coding sequence variant |
rs63751180 |
C>A,G,T |
Pathogenic |
Synonymous variant, stop gained, missense variant, coding sequence variant |
rs63751243 |
C>A,T |
Pathogenic, not-provided |
Missense variant, coding sequence variant |
rs63751294 |
C>T |
Pathogenic |
Stop gained, coding sequence variant |
rs63751296 |
G>C |
Pathogenic, not-provided |
Splice acceptor variant |
rs193026789 |
C>A,T |
Likely-benign, pathogenic |
Synonymous variant, stop gained, coding sequence variant |
rs606231220 |
->CCTG |
Pathogenic |
Coding sequence variant, frameshift variant |
rs606231221 |
G>A |
Pathogenic |
Splice donor variant |
rs770058074 |
C>A,T |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs778599933 |
TGAG>- |
Uncertain-significance, likely-pathogenic |
Splice donor variant, intron variant |
rs794729669 |
G>C |
Pathogenic |
Splice donor variant |
rs794729670 |
T>C,G |
Pathogenic |
Coding sequence variant, synonymous variant, stop gained |
rs794729671 |
->T |
Pathogenic |
Coding sequence variant, frameshift variant |
rs794729672 |
->C |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1392550887 |
->C |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1555610855 |
G>A |
Likely-pathogenic |
Stop gained, coding sequence variant |
rs1555611136 |
AG>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1555611154 |
G>A |
Pathogenic |
Splice acceptor variant |
rs1555611253 |
C>T |
Pathogenic |
Stop gained, coding sequence variant |
rs1555611256 |
G>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1555611293 |
C>T |
Pathogenic |
Stop gained, coding sequence variant |
rs1555611412 |
A>G |
Pathogenic |
Splice acceptor variant |
rs1555611439 |
->AACGT |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1567885658 |
->T |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1567885728 |
G>A |
Likely-pathogenic |
Splice donor variant |
rs1567886206 |
->A |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1567886445 |
->TGTGAAGACAGGGTGCACTGCTGTC |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1567886478 |
T>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1567887004 |
->CC |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1567887015 |
->A |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1567887496 |
C>T |
Pathogenic |
Coding sequence variant, stop gained |
rs1567887567 |
->AA |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1567887777 |
G>A |
Likely-pathogenic |
Synonymous variant, coding sequence variant |
rs1567888461 |
C>A |
Pathogenic |
Coding sequence variant, stop gained |
rs1598362746 |
G>A |
Pathogenic |
Coding sequence variant, stop gained |
rs1598363083 |
G>C |
Pathogenic |
Splice donor variant |
rs1598363490 |
->A |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1598364296 |
TCAGGCCAC>- |
Pathogenic |
Coding sequence variant, splice acceptor variant, intron variant |
rs1598364358 |
C>T |
Likely-pathogenic |
Coding sequence variant, stop gained |
rs1598364782 |
C>A |
Pathogenic |
Coding sequence variant, stop gained |
rs1598364961 |
AG>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
miRTarBase ID |
miRNA |
Experiments |
Reference |
MIRT004761 |
hsa-miR-107 |
Microarray, Western blot |
20884628 |
MIRT004761 |
hsa-miR-107 |
Microarray, Western blot |
20884628 |
MIRT004761 |
hsa-miR-107 |
Microarray, Western blot |
20884628 |
MIRT000034 |
hsa-miR-659-3p |
Luciferase reporter assay, Western blot |
18723524 |
MIRT000034 |
hsa-miR-659-3p |
Luciferase reporter assay, Western blot |
18723524 |
MIRT005486 |
hsa-miR-29b-3p |
ELISA, Luciferase reporter assay, qRT-PCR, Western blot |
20479936 |
MIRT005486 |
hsa-miR-29b-3p |
ELISA, Luciferase reporter assay, qRT-PCR, Western blot |
20479936 |
MIRT005486 |
hsa-miR-29b-3p |
ELISA, Luciferase reporter assay, qRT-PCR, Western blot |
20479936 |
MIRT005486 |
hsa-miR-29b-3p |
ELISA, Luciferase reporter assay, qRT-PCR, Western blot |
20479936 |
MIRT021404 |
hsa-miR-9-5p |
Reporter assay |
20479936 |
MIRT004761 |
hsa-miR-107 |
Reporter assay;Western blot;Microarray |
20489155 |
MIRT005486 |
hsa-miR-29b-3p |
Reporter assay;Western blot;Other |
20479936 |
MIRT627129 |
hsa-miR-8485 |
HITS-CLIP |
23824327 |
MIRT627127 |
hsa-miR-3939 |
HITS-CLIP |
23824327 |
MIRT627128 |
hsa-miR-7114-5p |
HITS-CLIP |
23824327 |
MIRT627126 |
hsa-miR-5191 |
HITS-CLIP |
23824327 |
MIRT627125 |
hsa-miR-376b-5p |
HITS-CLIP |
23824327 |
MIRT627124 |
hsa-miR-376c-5p |
HITS-CLIP |
23824327 |
MIRT627123 |
hsa-miR-3691-5p |
HITS-CLIP |
23824327 |
MIRT627121 |
hsa-miR-8056 |
HITS-CLIP |
23824327 |
MIRT627122 |
hsa-miR-4752 |
HITS-CLIP |
23824327 |
MIRT627129 |
hsa-miR-8485 |
HITS-CLIP |
23824327 |
MIRT627127 |
hsa-miR-3939 |
HITS-CLIP |
23824327 |
MIRT627128 |
hsa-miR-7114-5p |
HITS-CLIP |
23824327 |
MIRT627126 |
hsa-miR-5191 |
HITS-CLIP |
23824327 |
MIRT627125 |
hsa-miR-376b-5p |
HITS-CLIP |
23824327 |
MIRT627124 |
hsa-miR-376c-5p |
HITS-CLIP |
23824327 |
MIRT627123 |
hsa-miR-3691-5p |
HITS-CLIP |
23824327 |
MIRT627121 |
hsa-miR-8056 |
HITS-CLIP |
23824327 |
MIRT627122 |
hsa-miR-4752 |
HITS-CLIP |
23824327 |
MIRT627129 |
hsa-miR-8485 |
HITS-CLIP |
23824327 |
MIRT627127 |
hsa-miR-3939 |
HITS-CLIP |
23824327 |
MIRT627128 |
hsa-miR-7114-5p |
HITS-CLIP |
23824327 |
MIRT627126 |
hsa-miR-5191 |
HITS-CLIP |
23824327 |
MIRT627125 |
hsa-miR-376b-5p |
HITS-CLIP |
23824327 |
MIRT627124 |
hsa-miR-376c-5p |
HITS-CLIP |
23824327 |
MIRT627123 |
hsa-miR-3691-5p |
HITS-CLIP |
23824327 |
MIRT627121 |
hsa-miR-8056 |
HITS-CLIP |
23824327 |
MIRT627122 |
hsa-miR-4752 |
HITS-CLIP |
23824327 |
MIRT627129 |
hsa-miR-8485 |
HITS-CLIP |
23824327 |
MIRT627127 |
hsa-miR-3939 |
HITS-CLIP |
23824327 |
MIRT627128 |
hsa-miR-7114-5p |
HITS-CLIP |
23824327 |
MIRT627126 |
hsa-miR-5191 |
HITS-CLIP |
23824327 |
MIRT627125 |
hsa-miR-376b-5p |
HITS-CLIP |
23824327 |
MIRT627124 |
hsa-miR-376c-5p |
HITS-CLIP |
23824327 |
MIRT627123 |
hsa-miR-3691-5p |
HITS-CLIP |
23824327 |
MIRT627121 |
hsa-miR-8056 |
HITS-CLIP |
23824327 |
MIRT627122 |
hsa-miR-4752 |
HITS-CLIP |
23824327 |
MIRT627129 |
hsa-miR-8485 |
HITS-CLIP |
23824327 |
MIRT627127 |
hsa-miR-3939 |
HITS-CLIP |
23824327 |
MIRT627128 |
hsa-miR-7114-5p |
HITS-CLIP |
23824327 |
MIRT627126 |
hsa-miR-5191 |
HITS-CLIP |
23824327 |
MIRT627125 |
hsa-miR-376b-5p |
HITS-CLIP |
23824327 |
MIRT627124 |
hsa-miR-376c-5p |
HITS-CLIP |
23824327 |
MIRT627123 |
hsa-miR-3691-5p |
HITS-CLIP |
23824327 |
MIRT627121 |
hsa-miR-8056 |
HITS-CLIP |
23824327 |
MIRT627122 |
hsa-miR-4752 |
HITS-CLIP |
23824327 |
MIRT627129 |
hsa-miR-8485 |
HITS-CLIP |
23824327 |
MIRT627127 |
hsa-miR-3939 |
HITS-CLIP |
23824327 |
MIRT627128 |
hsa-miR-7114-5p |
HITS-CLIP |
23824327 |
MIRT627126 |
hsa-miR-5191 |
HITS-CLIP |
23824327 |
MIRT627125 |
hsa-miR-376b-5p |
HITS-CLIP |
23824327 |
MIRT627124 |
hsa-miR-376c-5p |
HITS-CLIP |
23824327 |
MIRT627123 |
hsa-miR-3691-5p |
HITS-CLIP |
23824327 |
MIRT627121 |
hsa-miR-8056 |
HITS-CLIP |
23824327 |
MIRT627122 |
hsa-miR-4752 |
HITS-CLIP |
23824327 |
MIRT1035277 |
hsa-miR-1321 |
CLIP-seq |
|
MIRT1035278 |
hsa-miR-2054 |
CLIP-seq |
|
MIRT1035279 |
hsa-miR-3119 |
CLIP-seq |
|
MIRT1035280 |
hsa-miR-3140-3p |
CLIP-seq |
|
MIRT1035281 |
hsa-miR-3150a-3p |
CLIP-seq |
|
MIRT1035282 |
hsa-miR-3162-5p |
CLIP-seq |
|
MIRT1035283 |
hsa-miR-3175 |
CLIP-seq |
|
MIRT1035284 |
hsa-miR-3670 |
CLIP-seq |
|
MIRT1035285 |
hsa-miR-3689d |
CLIP-seq |
|
MIRT1035286 |
hsa-miR-4270 |
CLIP-seq |
|
MIRT1035287 |
hsa-miR-4278 |
CLIP-seq |
|
MIRT1035288 |
hsa-miR-4300 |
CLIP-seq |
|
MIRT1035289 |
hsa-miR-4441 |
CLIP-seq |
|
MIRT1035290 |
hsa-miR-4474-3p |
CLIP-seq |
|
MIRT1035291 |
hsa-miR-4685-5p |
CLIP-seq |
|
MIRT1035292 |
hsa-miR-4716-3p |
CLIP-seq |
|
MIRT1035293 |
hsa-miR-4723-5p |
CLIP-seq |
|
MIRT1035294 |
hsa-miR-4728-5p |
CLIP-seq |
|
MIRT1035295 |
hsa-miR-4739 |
CLIP-seq |
|
MIRT1035296 |
hsa-miR-4756-5p |
CLIP-seq |
|
MIRT1035297 |
hsa-miR-615-5p |
CLIP-seq |
|
MIRT1035298 |
hsa-miR-659 |
CLIP-seq |
|
MIRT1035299 |
hsa-miR-885-3p |
CLIP-seq |
|
MIRT1035300 |
hsa-miR-920 |
CLIP-seq |
|
MIRT1035301 |
hsa-miR-939 |
CLIP-seq |
|
MIRT1035277 |
hsa-miR-1321 |
CLIP-seq |
|
MIRT2006946 |
hsa-miR-1470 |
CLIP-seq |
|
MIRT2006947 |
hsa-miR-2467-3p |
CLIP-seq |
|
MIRT1035282 |
hsa-miR-3162-5p |
CLIP-seq |
|
MIRT2006948 |
hsa-miR-3616-3p |
CLIP-seq |
|
MIRT1035285 |
hsa-miR-3689d |
CLIP-seq |
|
MIRT1035287 |
hsa-miR-4278 |
CLIP-seq |
|
MIRT2006949 |
hsa-miR-4468 |
CLIP-seq |
|
MIRT2006950 |
hsa-miR-4481 |
CLIP-seq |
|
MIRT1035292 |
hsa-miR-4716-3p |
CLIP-seq |
|
MIRT1035293 |
hsa-miR-4723-5p |
CLIP-seq |
|
MIRT1035294 |
hsa-miR-4728-5p |
CLIP-seq |
|
MIRT1035295 |
hsa-miR-4739 |
CLIP-seq |
|
MIRT2006951 |
hsa-miR-4745-5p |
CLIP-seq |
|
MIRT1035296 |
hsa-miR-4756-5p |
CLIP-seq |
|
MIRT1035297 |
hsa-miR-615-5p |
CLIP-seq |
|
MIRT1035298 |
hsa-miR-659 |
CLIP-seq |
|
MIRT1035299 |
hsa-miR-885-3p |
CLIP-seq |
|
MIRT2239479 |
hsa-miR-4701-5p |
CLIP-seq |
|
MIRT1035294 |
hsa-miR-4728-5p |
CLIP-seq |
|
MIRT1035294 |
hsa-miR-4728-5p |
CLIP-seq |
|
MIRT1035299 |
hsa-miR-885-3p |
CLIP-seq |
|
MIRT2437502 |
hsa-miR-1237 |
CLIP-seq |
|
MIRT1035278 |
hsa-miR-2054 |
CLIP-seq |
|
MIRT2437503 |
hsa-miR-3064-3p |
CLIP-seq |
|
MIRT1035279 |
hsa-miR-3119 |
CLIP-seq |
|
MIRT2437504 |
hsa-miR-3127-3p |
CLIP-seq |
|
MIRT1035280 |
hsa-miR-3140-3p |
CLIP-seq |
|
MIRT2437505 |
hsa-miR-3660 |
CLIP-seq |
|
MIRT2437506 |
hsa-miR-4256 |
CLIP-seq |
|
MIRT1035290 |
hsa-miR-4474-3p |
CLIP-seq |
|
MIRT2437507 |
hsa-miR-4526 |
CLIP-seq |
|
MIRT2437508 |
hsa-miR-4640-3p |
CLIP-seq |
|
MIRT2437509 |
hsa-miR-4715-3p |
CLIP-seq |
|
MIRT1035294 |
hsa-miR-4728-5p |
CLIP-seq |
|
MIRT2437510 |
hsa-miR-4776-3p |
CLIP-seq |
|
MIRT1035299 |
hsa-miR-885-3p |
CLIP-seq |
|
MIRT2543202 |
hsa-miR-1224-3p |
CLIP-seq |
|
MIRT2437502 |
hsa-miR-1237 |
CLIP-seq |
|
MIRT2543203 |
hsa-miR-1245b-5p |
CLIP-seq |
|
MIRT2543204 |
hsa-miR-1304 |
CLIP-seq |
|
MIRT1035277 |
hsa-miR-1321 |
CLIP-seq |
|
MIRT2006946 |
hsa-miR-1470 |
CLIP-seq |
|
MIRT1035278 |
hsa-miR-2054 |
CLIP-seq |
|
MIRT2006947 |
hsa-miR-2467-3p |
CLIP-seq |
|
MIRT2437503 |
hsa-miR-3064-3p |
CLIP-seq |
|
MIRT1035279 |
hsa-miR-3119 |
CLIP-seq |
|
MIRT2437504 |
hsa-miR-3127-3p |
CLIP-seq |
|
MIRT1035280 |
hsa-miR-3140-3p |
CLIP-seq |
|
MIRT2543205 |
hsa-miR-3142 |
CLIP-seq |
|
MIRT1035281 |
hsa-miR-3150a-3p |
CLIP-seq |
|
MIRT2543206 |
hsa-miR-3158-5p |
CLIP-seq |
|
MIRT1035282 |
hsa-miR-3162-5p |
CLIP-seq |
|
MIRT1035283 |
hsa-miR-3175 |
CLIP-seq |
|
MIRT2006948 |
hsa-miR-3616-3p |
CLIP-seq |
|
MIRT2437505 |
hsa-miR-3660 |
CLIP-seq |
|
MIRT1035284 |
hsa-miR-3670 |
CLIP-seq |
|
MIRT2543207 |
hsa-miR-3678-3p |
CLIP-seq |
|
MIRT1035285 |
hsa-miR-3689d |
CLIP-seq |
|
MIRT2437506 |
hsa-miR-4256 |
CLIP-seq |
|
MIRT1035286 |
hsa-miR-4270 |
CLIP-seq |
|
MIRT1035287 |
hsa-miR-4278 |
CLIP-seq |
|
MIRT2543208 |
hsa-miR-4281 |
CLIP-seq |
|
MIRT1035288 |
hsa-miR-4300 |
CLIP-seq |
|
MIRT1035289 |
hsa-miR-4441 |
CLIP-seq |
|
MIRT2543209 |
hsa-miR-4446-3p |
CLIP-seq |
|
MIRT2006949 |
hsa-miR-4468 |
CLIP-seq |
|
MIRT1035290 |
hsa-miR-4474-3p |
CLIP-seq |
|
MIRT2006950 |
hsa-miR-4481 |
CLIP-seq |
|
MIRT2543210 |
hsa-miR-4493 |
CLIP-seq |
|
MIRT2437507 |
hsa-miR-4526 |
CLIP-seq |
|
MIRT2437508 |
hsa-miR-4640-3p |
CLIP-seq |
|
MIRT1035291 |
hsa-miR-4685-5p |
CLIP-seq |
|
MIRT2437509 |
hsa-miR-4715-3p |
CLIP-seq |
|
MIRT1035292 |
hsa-miR-4716-3p |
CLIP-seq |
|
MIRT2543211 |
hsa-miR-4721 |
CLIP-seq |
|
MIRT1035293 |
hsa-miR-4723-5p |
CLIP-seq |
|
MIRT1035294 |
hsa-miR-4728-5p |
CLIP-seq |
|
MIRT1035295 |
hsa-miR-4739 |
CLIP-seq |
|
MIRT2543212 |
hsa-miR-4740-3p |
CLIP-seq |
|
MIRT2006951 |
hsa-miR-4745-5p |
CLIP-seq |
|
MIRT2543213 |
hsa-miR-4747-5p |
CLIP-seq |
|
MIRT1035296 |
hsa-miR-4756-5p |
CLIP-seq |
|
MIRT2543214 |
hsa-miR-4758-3p |
CLIP-seq |
|
MIRT2543215 |
hsa-miR-4760-5p |
CLIP-seq |
|
MIRT2437510 |
hsa-miR-4776-3p |
CLIP-seq |
|
MIRT1035297 |
hsa-miR-615-5p |
CLIP-seq |
|
MIRT1035298 |
hsa-miR-659 |
CLIP-seq |
|
MIRT1035299 |
hsa-miR-885-3p |
CLIP-seq |
|
MIRT1035300 |
hsa-miR-920 |
CLIP-seq |
|
MIRT1035301 |
hsa-miR-939 |
CLIP-seq |
|
MIRT2543202 |
hsa-miR-1224-3p |
CLIP-seq |
|
MIRT2437502 |
hsa-miR-1237 |
CLIP-seq |
|
MIRT2543203 |
hsa-miR-1245b-5p |
CLIP-seq |
|
MIRT2543204 |
hsa-miR-1304 |
CLIP-seq |
|
MIRT1035277 |
hsa-miR-1321 |
CLIP-seq |
|
MIRT2006946 |
hsa-miR-1470 |
CLIP-seq |
|
MIRT1035278 |
hsa-miR-2054 |
CLIP-seq |
|
MIRT2006947 |
hsa-miR-2467-3p |
CLIP-seq |
|
MIRT2437503 |
hsa-miR-3064-3p |
CLIP-seq |
|
MIRT1035279 |
hsa-miR-3119 |
CLIP-seq |
|
MIRT2437504 |
hsa-miR-3127-3p |
CLIP-seq |
|
MIRT1035280 |
hsa-miR-3140-3p |
CLIP-seq |
|
MIRT2543205 |
hsa-miR-3142 |
CLIP-seq |
|
MIRT1035281 |
hsa-miR-3150a-3p |
CLIP-seq |
|
MIRT2543206 |
hsa-miR-3158-5p |
CLIP-seq |
|
MIRT1035282 |
hsa-miR-3162-5p |
CLIP-seq |
|
MIRT1035283 |
hsa-miR-3175 |
CLIP-seq |
|
MIRT2006948 |
hsa-miR-3616-3p |
CLIP-seq |
|
MIRT2437505 |
hsa-miR-3660 |
CLIP-seq |
|
MIRT1035284 |
hsa-miR-3670 |
CLIP-seq |
|
MIRT2543207 |
hsa-miR-3678-3p |
CLIP-seq |
|
MIRT1035285 |
hsa-miR-3689d |
CLIP-seq |
|
MIRT2437506 |
hsa-miR-4256 |
CLIP-seq |
|
MIRT1035286 |
hsa-miR-4270 |
CLIP-seq |
|
MIRT1035287 |
hsa-miR-4278 |
CLIP-seq |
|
MIRT2543208 |
hsa-miR-4281 |
CLIP-seq |
|
MIRT1035288 |
hsa-miR-4300 |
CLIP-seq |
|
MIRT1035289 |
hsa-miR-4441 |
CLIP-seq |
|
MIRT2543209 |
hsa-miR-4446-3p |
CLIP-seq |
|
MIRT2006949 |
hsa-miR-4468 |
CLIP-seq |
|
MIRT1035290 |
hsa-miR-4474-3p |
CLIP-seq |
|
MIRT2006950 |
hsa-miR-4481 |
CLIP-seq |
|
MIRT2543210 |
hsa-miR-4493 |
CLIP-seq |
|
MIRT2437507 |
hsa-miR-4526 |
CLIP-seq |
|
MIRT2437508 |
hsa-miR-4640-3p |
CLIP-seq |
|
MIRT1035291 |
hsa-miR-4685-5p |
CLIP-seq |
|
MIRT2437509 |
hsa-miR-4715-3p |
CLIP-seq |
|
MIRT1035292 |
hsa-miR-4716-3p |
CLIP-seq |
|
MIRT2543211 |
hsa-miR-4721 |
CLIP-seq |
|
MIRT1035293 |
hsa-miR-4723-5p |
CLIP-seq |
|
MIRT1035294 |
hsa-miR-4728-5p |
CLIP-seq |
|
MIRT1035295 |
hsa-miR-4739 |
CLIP-seq |
|
MIRT2543212 |
hsa-miR-4740-3p |
CLIP-seq |
|
MIRT2006951 |
hsa-miR-4745-5p |
CLIP-seq |
|
MIRT2543213 |
hsa-miR-4747-5p |
CLIP-seq |
|
MIRT1035296 |
hsa-miR-4756-5p |
CLIP-seq |
|
MIRT2543214 |
hsa-miR-4758-3p |
CLIP-seq |
|
MIRT2543215 |
hsa-miR-4760-5p |
CLIP-seq |
|
MIRT2437510 |
hsa-miR-4776-3p |
CLIP-seq |
|
MIRT1035297 |
hsa-miR-615-5p |
CLIP-seq |
|
MIRT1035298 |
hsa-miR-659 |
CLIP-seq |
|
MIRT1035299 |
hsa-miR-885-3p |
CLIP-seq |
|
MIRT1035300 |
hsa-miR-920 |
CLIP-seq |
|
MIRT1035301 |
hsa-miR-939 |
CLIP-seq |
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
GO ID |
Ontology |
Definition |
Evidence |
Reference |
GO:0002265 |
Process |
Astrocyte activation involved in immune response |
ISS |
|
GO:0002282 |
Process |
Microglial cell activation involved in immune response |
ISS |
|
GO:0003723 |
Function |
RNA binding |
HDA |
22658674 |
GO:0005125 |
Function |
Cytokine activity |
IEA |
|
GO:0005515 |
Function |
Protein binding |
IPI |
12526812, 16189514, 21078624, 21092856, 21516116, 21988832, 23088713, 23236149, 24070898, 25416956, 25839164, 25910212, 26370502, 27789271, 28453791, 28493053, 28541286, 29892012, 31515488, 32296183, 32814053 |
GO:0005576 |
Component |
Extracellular region |
IBA |
21873635 |
GO:0005576 |
Component |
Extracellular region |
IDA |
21092856, 26370502 |
GO:0005576 |
Component |
Extracellular region |
TAS |
|
GO:0005615 |
Component |
Extracellular space |
IDA |
20479936 |
GO:0005764 |
Component |
Lysosome |
IDA |
26370502, 28073925, 28541286, 28743268 |
GO:0005765 |
Component |
Lysosomal membrane |
IDA |
21092856 |
GO:0005768 |
Component |
Endosome |
IDA |
|
GO:0005770 |
Component |
Late endosome |
IDA |
26370502 |
GO:0005783 |
Component |
Endoplasmic reticulum |
IDA |
26370502, 28073925 |
GO:0005794 |
Component |
Golgi apparatus |
IDA |
28073925 |
GO:0005802 |
Component |
Trans-Golgi network |
ISS |
|
GO:0005886 |
Component |
Plasma membrane |
IDA |
21092856 |
GO:0007040 |
Process |
Lysosome organization |
ISS |
|
GO:0007041 |
Process |
Lysosomal transport |
IMP |
28541286 |
GO:0007041 |
Process |
Lysosomal transport |
ISS |
|
GO:0007042 |
Process |
Lysosomal lumen acidification |
IMP |
28073925 |
GO:0007165 |
Process |
Signal transduction |
NAS |
1542665 |
GO:0008083 |
Function |
Growth factor activity |
TAS |
1542665 |
GO:0010595 |
Process |
Positive regulation of endothelial cell migration |
ISS |
|
GO:0016020 |
Component |
Membrane |
IDA |
28073925 |
GO:0030335 |
Process |
Positive regulation of cell migration |
IMP |
27571908 |
GO:0035578 |
Component |
Azurophil granule lumen |
TAS |
|
GO:0043312 |
Process |
Neutrophil degranulation |
TAS |
|
GO:0043524 |
Process |
Negative regulation of neuron apoptotic process |
IDA |
18378771 |
GO:0043525 |
Process |
Positive regulation of neuron apoptotic process |
ISS |
|
GO:0045766 |
Process |
Positive regulation of angiogenesis |
ISS |
|
GO:0048680 |
Process |
Positive regulation of axon regeneration |
ISS |
|
GO:0050679 |
Process |
Positive regulation of epithelial cell proliferation |
IDA |
12526812 |
GO:0050727 |
Process |
Regulation of inflammatory response |
IBA |
21873635 |
GO:0050821 |
Process |
Protein stabilization |
IMP |
28453791 |
GO:0051087 |
Function |
Chaperone binding |
IDA |
27789271 |
GO:0060266 |
Process |
Negative regulation of respiratory burst involved in inflammatory response |
IDA |
12526812 |
GO:0070062 |
Component |
Extracellular exosome |
HDA |
23533145 |
GO:0106016 |
Process |
Positive regulation of inflammatory response to wounding |
ISS |
|
GO:1900426 |
Process |
Positive regulation of defense response to bacterium |
ISS |
|
GO:1902564 |
Process |
Negative regulation of neutrophil activation |
IDA |
12526812 |
GO:1903334 |
Process |
Positive regulation of protein folding |
ISS |
|
GO:1903979 |
Process |
Negative regulation of microglial cell activation |
ISS |
|
GO:1905247 |
Process |
Positive regulation of aspartic-type peptidase activity |
IMP |
28453791 |
GO:1905247 |
Process |
Positive regulation of aspartic-type peptidase activity |
ISS |
|
GO:1905673 |
Process |
Positive regulation of lysosome organization |
IDA |
28073925 |
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P28799 |
Protein name |
Progranulin (PGRN) (Acrogranin) (Epithelin precursor) (Glycoprotein of 88 Kda) (GP88) (Glycoprotein 88) (Granulin precursor) (PC cell-derived growth factor) (PCDGF) (Proepithelin) (PEPI) [Cleaved into: Paragranulin; Granulin-1 (Granulin G); Granulin-2 (Gr |
Protein function |
Secreted protein that acts as a key regulator of lysosomal function and as a growth factor involved in inflammation, wound healing and cell proliferation (PubMed:12526812, PubMed:18378771, PubMed:28073925, PubMed:28453791, PubMed:28541286). Regu |
PDB |
1G26
,
2JYE
,
2JYT
,
2JYU
,
2JYV
,
6NUG
,
8T8R
,
8T8S
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF00396 |
Granulin |
72 → 113 |
Granulin |
Family |
PF00396 |
Granulin |
138 → 179 |
Granulin |
Family |
PF00396 |
Granulin |
220 → 261 |
Granulin |
Family |
PF00396 |
Granulin |
295 → 336 |
Granulin |
Family |
PF00396 |
Granulin |
377 → 417 |
Granulin |
Family |
PF00396 |
Granulin |
455 → 496 |
Granulin |
Family |
PF00396 |
Granulin |
532 → 573 |
Granulin |
Family |
|
Sequence |
|
Sequence length |
593 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Alzheimer disease |
Alzheimer`s Disease |
rs63750215, rs28936379, rs63749851, rs63749884, rs28936380, rs63750048, rs63750579, rs63750264, rs63749964, rs63750671, rs281865161, rs63750066, rs63750399, rs63750734, rs63751039, rs63750973, rs63749810, rs63750643, rs193922916, rs63750306, rs63750590, rs63750526, rs63751235, rs661, rs63751037, rs63749885, rs63750231, rs63751229, rs63751272, rs63751223, rs63750391, rs63751163, rs281875357, rs63751141, rs63750082, rs121917807, rs63751399, rs63750265, rs63751144, rs63750886, rs63751068, rs121917808, rs63749891, rs63750083, rs63749824, rs63750577, rs267606983, rs63750218, rs63751287, rs63750900, rs145518263, rs63751475, rs63750450, rs63749805, rs63751278, rs63751106, rs63750004, rs63749806, rs63751024, rs63750248, rs63750779, rs63751139, rs63750219, rs63750298, rs63750687, rs63750851, rs1553268799, rs1561901881, rs1561905293, rs866101707, rs1566638673, rs63750009, rs1566656702, rs1566657804, rs1567885728, rs1568339995, rs1566630791, rs1555358260, rs63750964, rs1594998354, rs63751316 |
|
Apraxia |
Apraxias |
rs121908377, rs121908378, rs1135401820, rs1178491246, rs1584969672 |
|
Ceroid lipofuscinosis neuronal |
CEROID LIPOFUSCINOSIS, NEURONAL, 11 |
rs121434286, rs267606737, rs104894483, rs121908079, rs786205065, rs397515352, rs774543080, rs121908080, rs104894486, rs786205067, rs154774633, rs154774634, rs154774636, rs587776892, rs387907043, rs154774640, rs154774639, rs587779408, rs786201028, rs1555438234, rs1451777867, rs762902907, rs756522171, rs1555440188, rs1555440206, rs1555438212, rs1555438229, rs1555438411, rs1555438443, rs1555438614, rs758921701, rs1567095153, rs1381427322, rs1012449574, rs1600887859 |
23338682, 16950801, 28264768, 27258413, 20142524, 22608501, 17202431, 18183624, 16862116, 22647257, 21482928, 17334266, 17439980 |
Myasthenic syndrome |
Congenital myasthenic syndrome ib |
rs606231128, rs606231129, rs606231130, rs606231131, rs606231132, rs118203994, rs118203995, rs863223277, rs606231133, rs121908547, rs121908553, rs121908557, rs104893733, rs104893734, rs121908922, rs769982050, rs759911990, rs121908923, rs121908924, rs1384843815, rs104893735, rs104894299, rs104894300, rs786200904, rs104894301, rs786200905, rs104894294, rs121909254, rs121909255, rs879255561, rs121912821, rs75466054, rs121912822, rs199476396, rs121909510, rs121909511, rs121909514, rs121909512, rs121909513, rs879255562, rs879253722, rs879253723, rs28999110, rs886037628, rs753828284, rs121909515, rs121909516, rs121909517, rs879255563, rs121909502, rs121909503, rs121909504, rs879255564, rs121909505, rs121909508, rs137852810, rs137852811, rs137852798, rs137852800, rs137852801, rs137852802, rs137852804, rs137852805, rs137852806, rs137852807, rs137852808, rs2105350984, rs374391312, rs201322234, rs1671535986, rs1574066341, rs1574058076, rs1574066599, rs387906803, rs387907243, rs376039938, rs397515321, rs387907244, rs387907245, rs377767449, rs193919341, rs398122830, rs397515450, rs587777298, rs587777299, rs587777781, rs730882050, rs730882123, rs730882051, rs786204773, rs786205885, rs794727884, rs761899995, rs797045040, rs797045528, rs200783529, rs551423795, rs756877019, rs864309662, rs864309663, rs756623659, rs773526895, rs763258280, rs762368691, rs1555794286, rs886037842, rs147656110, rs886039767, rs886039768, rs770045897, rs763281993, rs755236236, rs886043239, rs764497513, rs1057517666, rs370019023, rs769114543, rs922548333, rs139574075, rs767507908, rs759226183, rs1057523690, rs55868108, rs755303686, rs1085307792, rs775583136, rs376808313, rs1131691986, rs776927709, rs1279554995, rs1553850100, rs1156634884, rs1553390600, rs1349476281, rs1555546465, rs199875082, rs200761047, rs1553360075, rs971863968, rs369251527, rs372760913, rs1479498379, rs1555547003, rs1423995073, rs1555546315, rs1555546765, rs201033437, rs1430654625, rs1554943789, rs1316112168, rs781689096, rs1553354962, rs753545038, rs1011196447, rs1553389102, rs185829251, rs28929768, rs1555546096, rs932032926, rs1553846331, rs756015202, rs1555142142, rs1436090495, rs1553352792, rs145356495, rs770987150, rs768892432, rs1557700705, rs1172015222, rs1558749457, rs1361739547, rs775517492, rs1558773839, rs1559510978, rs771879602, rs777102590, rs1567635954, rs1407243713, rs1567638401, rs756675414, rs781908532, rs1306593300, rs1559519107, rs199470447, rs1557721600, rs1558762013, rs746220436, rs1565527239, rs1565527137, rs1565527140, rs1567636493, rs1558761046, rs143766249, rs1447564693, rs757060689, rs1309292778, rs1575460231, rs1570193864, rs1570195582, rs1239736447, rs779488471, rs201947904, rs1597612665, rs1597613302, rs781774131, rs760022829, rs1597619440, rs1597621353, rs1187421976, rs977512223, rs1239393228, rs762875734, rs148092524, rs1269227357, rs1208462125, rs1597622118, rs1597749210, rs1570190059, rs1574007436, rs781974501, rs748639083, rs1597613479, rs1597621396, rs1570242061, rs149020371, rs1595903667, rs1597618787, rs1600807788, rs1579484850, rs1577153029, rs779816027, rs1598406692, rs1577153124, rs778172294, rs1590576560, rs753652169, rs1595902947, rs1369980189, rs762345055, rs1675812434, rs375268742, rs1671813157, rs759488854, rs761584017, rs1969834618, rs1969839736, rs1255916068, rs1597618854, rs1969973509, rs1908994498, rs1320610655, rs373710822 |
|
Frontotemporal dementia |
Frontotemporal dementia, Frontotemporal Lobar Degeneration |
rs63751273, rs63750376, rs63750424, rs63750972, rs1568327531, rs63750570, rs63750756, rs63751165, rs63750512, rs63751438, rs63750912, rs63750711, rs63750635, rs63750349, rs63750092, rs63749801, rs63751399, rs199476352, rs63751035, rs63749974, rs63750568, rs63750013, rs63751394, rs63750308, rs63751011, rs63750095, rs794729672, rs794729669, rs63749817, rs794729670, rs193026789, rs794729671, rs1085307051, rs1566630811, rs1566630884, rs1567885658, rs1567886206, rs1567886445, rs1567886478, rs1567887015, rs1567887777, rs1567888461, rs1566630791, rs1598408073, rs1570725499, rs1598408336 |
21454553, 17923627, 22028881, 20154673 |
Neuronal ceroid lipofuscinosis |
CLN11 disease |
rs118203975, rs118203976, rs118203977, rs267607235, rs140948465, rs1740291234, rs386833969, rs104894385, rs104894386, rs121908292, rs267606738, rs1555274312, rs119455953, rs119455954, rs119455955, rs56144125, rs119455956, rs28940573, rs119455957, rs119455958, rs104894064, rs28940569, rs104894060, rs137852883, rs1555468634, rs121434286, rs267606737, rs104894483, rs397515352, rs774543080, rs121908080, rs786205067, rs137852695, rs137852696, rs137852697, rs137852698, rs137852699, rs137852700, rs137852701, rs137852702, rs63749877, rs121912789, rs121912790, rs786205105, rs154774634, rs587776892, rs387907246, rs386833624, rs386833626, rs386833625, rs386833627, rs386833628, rs386833629, rs386833630, rs386833632, rs386833633, rs386833634, rs386833635, rs386833636, rs386833637, rs386833638, rs386833641, rs386833642, rs386833643, rs386833644, rs386833645, rs386833646, rs386833647, rs386833648, rs386833649, rs386833650, rs386833651, rs386833652, rs386833653, rs148412181, rs386833654, rs386833655, rs386833656, rs386833657, rs386833658, rs386833659, rs386833660, rs386833661, rs386833663, rs386833664, rs386833665, rs386833666, rs386833667, rs386833668, rs386833669, rs386833671, rs386833694, rs386833695, rs386833696, rs386833697, rs386833698, rs386833699, rs386833700, rs386833701, rs386833702, rs386833703, rs386833704, rs386833705, rs386833706, rs386833707, rs386833708, rs386833709, rs386833710, rs386833712, rs386833713, rs386833714, rs386833715, rs386833717, rs386833720, rs386833721, rs386833722, rs386833724, rs386833725, rs386833726, rs386833728, rs386833729, rs386833730, rs386833731, rs386833732, rs386833735, rs386833736, rs386833737, rs386833739, rs386833740, rs386833741, rs386833742, rs386833743, rs386833744, rs386833963, rs386833964, rs386833965, rs386833966, rs386833967, rs386833970, rs386833971, rs386833972, rs386833973, rs386833974, rs386833975, rs386833978, rs386833979, rs386833980, rs386833981, rs386833982, rs386833983, rs386834123, rs386834124, rs386834125, rs386834126, rs386834128, rs386834130, rs386834132, rs386834133, rs386834135, rs34238807, rs386834138, rs386834139, rs397514731, rs397514732, rs753084727, rs587778809, rs154774640, rs154774639, rs121908197, rs121908198, rs121908199, rs121908200, rs121908201, rs121908203, rs121908202, rs121908195, rs121908204, rs121908205, rs121908209, rs121908207, rs104895127, rs63750411, rs587779397, rs587780315, rs724159970, rs727502800, rs727502801, rs724159971, rs746645358, rs786204553, rs786204753, rs778232650, rs786204644, rs794727955, rs794729218, rs796052925, rs796052923, rs796052927, rs558274487, rs796052752, rs144495588, rs1554901472, rs750428882, rs796053439, rs763162812, rs756564767, rs202189057, rs759080581, rs746085696, rs546989392, rs143781303, rs796052356, rs796052351, rs796052335, rs797045136, rs797045137, rs765097897, rs864309505, rs869025274, rs869312751, rs1085307087, rs878853322, rs878853325, rs878853929, rs878855053, rs878855331, rs553522118, rs748710466, rs886041568, rs886041487, rs886041546, rs1057516575, rs1057516889, rs1057517401, rs1057516447, rs1057517049, rs1057517192, rs1057517368, rs1057517112, rs747204624, rs1057516867, rs1057516582, rs756267448, rs1057516579, rs1057516511, rs1057516264, rs1057516319, rs113019349, rs1057517313, rs1057516945, rs752164603, rs1057516366, rs1057516667, rs1057516814, rs780198002, rs1057517134, rs1057516390, rs764495616, rs750935331, rs1057516677, rs1057516267, rs771788391, rs1057517350, rs1057516335, rs1057517287, rs1057517215, rs1057516343, rs777625354, rs764051026, rs559155109, rs1064796787, rs139842473, rs1064794233, rs181995380, rs1064795153, rs752612332, rs1131691676, rs1131691539, rs1555438255, rs1555058286, rs1555274005, rs1555468632, rs200348035, rs1265044710, rs1439582451, rs751696703, rs761621368, rs143730802, rs1554901580, rs1554902052, rs1553950197, rs200319160, rs143657539, rs1554901523, rs1555274338, rs1555273604, rs1555273881, rs1216139602, rs762226836, rs1553167863, rs1553166135, rs1553166147, rs1553167430, rs1349528345, rs1553166499, rs1553166337, rs1553167415, rs1553167474, rs1553167479, rs1554451504, rs746397087, rs1554449028, rs759830733, rs1554449124, rs554042394, rs1554451484, rs1554448874, rs1554448924, rs1554449047, rs1554449136, rs1554901463, rs1184563885, rs1554902043, rs763961289, rs1407106889, rs1554901576, rs1554901731, rs1424116749, rs1554901784, rs1554902216, rs779615685, rs1554902085, rs764790770, rs1555274343, rs1555274369, rs1555273567, rs1555274365, rs1555273609, rs1555274344, rs1555274373, rs1555274387, rs1451777867, rs762902907, rs756522171, rs1555438212, rs1555438443, rs1555468374, rs1555469452, rs1555467473, rs1418997146, rs1555273882, rs1478660606, rs1555273992, rs1555274014, rs1555274337, rs142456044, rs1555469159, rs758921701, rs1555469089, rs1555469477, rs1554901898, rs1554902217, rs1564855860, rs1564854729, rs1460276679, rs1560776422, rs556661896, rs868732642, rs1564855725, rs1566219136, rs1381427322, rs1557714302, rs1593914689, rs1302326945, rs1570470281, rs1570476221, rs775699005, rs1578912362, rs750162094, rs759664259, rs1589947644, rs1012449574, rs1570467252, rs778875017, rs1578794927, rs1578912759, rs1314967038, rs1465284719, rs1595816465, rs1595816474, rs1596563048, rs1565311875, rs2046113301, rs1578889355, rs776253867, rs1649597261, rs1649901192, rs749315686, rs1801297484, rs764256845, rs1242337070, rs2034349431, rs1380684360, rs1648444864, rs1739594685, rs1736369601, rs1739482158, rs1471253353, rs2046243804, rs1845791308, rs1397197980, rs2046158549 |
|
Optic atrophy |
Optic Atrophy |
rs121434508, rs267607017, rs80356524, rs80356525, rs879255560, rs104893753, rs80356529, rs397515360, rs104893620, rs199476104, rs199476112, rs199476118, rs398124298, rs770066665, rs398124299, rs61750185, rs672601379, rs727504060, rs786204830, rs794727804, rs199946797, rs863224127, rs863224131, rs863224134, rs863224906, rs372054380, rs886037828, rs764791523, rs145639028, rs1057519312, rs1064794257, rs1064794656, rs1064797303, rs774265764, rs760337383, rs1553784985, rs72653786, rs1555229948, rs1555119216, rs761743852, rs1553785338, rs1020764190, rs782581701, rs1560408865, rs761460379, rs773022324, rs782740998, rs1560327427, rs80356528, rs1734162973, rs1716524583, rs1057368575 |
|
Parkinson disease |
Parkinsonian Disorders |
rs116074753, rs118203903, rs118203904, rs115735611, rs33939927, rs35801418, rs34805604, rs35870237, rs34995376, rs74315355, rs28940284, rs74315356, rs74315357, rs28940285, rs730880302, rs750664040, rs74315359, rs74315360, rs45539432, rs74315361, rs119451946, rs80356771, rs74500255, rs75822236, rs1141814, rs78973108, rs121908681, rs121908686, rs121908687, rs137853054, rs137853055, rs137853056, rs137853057, rs137853058, rs137853059, rs34424986, rs137853060, rs397518439, rs28938172, rs74315351, rs74315353, rs137853051, rs118192098, rs121917767, rs121918104, rs1589451049, rs104893877, rs104893878, rs283413, rs112176450, rs111290936, rs188286943, rs387906863, rs387906864, rs774631197, rs199935023, rs387906942, rs397514694, rs398122403, rs398122404, rs398122405, rs104886460, rs409652, rs431905511, rs63751392, rs756677845, rs864309527, rs864309650, rs750014782, rs1554391082, rs864622011, rs869312810, rs869312809, rs869312811, rs369100678, rs879253853, rs869320761, rs747506979, rs879255630, rs886039854, rs191486604, rs781442277, rs1060499619, rs751037529, rs55777503, rs768091663, rs34208370, rs1553122929, rs772786691, rs754809877, rs1555907463, rs1557561340, rs781600849, rs141263564, rs1557901552, rs777160388, rs756783990, rs867929413, rs1237637353, rs1005937012, rs755000580, rs747427602, rs1578089802, rs771586218, rs748142049, rs1582953433, rs746646126, rs771529549, rs121918106 |
|
Retinal dystrophy |
Retinal Dystrophies |
rs267606794, rs200691042, rs397704718, rs202193201, rs794728002, rs121965036, rs121965057, rs121918129, rs137853190, rs386834252, rs121918165, rs137853113, rs137853114, rs121918328, rs587777803, rs121908282, rs549625604, rs137852837, rs281865192, rs80044281, rs75895925, rs121918244, rs750962965, rs104893678, rs104893680, rs28940313, rs386834261, rs28940314, rs104894471, rs104894474, rs104894475, rs28940315, rs121434337, rs202126574, rs111033578, rs119103283, rs199476183, rs267607017, rs80338903, rs111033367, rs121912599, rs80338902, rs111033364, rs121912600, rs121909398, rs119103286, rs587777809, rs606231137, rs28940274, rs28941468, rs28941469, rs121918283, rs28940276, rs28940570, rs28940278, rs281865528, rs121918284, rs121918286, rs121918288, rs121918289, rs80100937, rs119466001, rs121434241, rs121434242, rs121434236, rs121434238, rs121907899, rs267606876, rs267606875, rs121434286, rs387906312, rs587776590, rs111033258, rs587776595, rs587776596, rs1362648752, rs74315205, rs121908175, rs121908177, rs121908178, rs138043021, rs121908180, rs111033270, rs1131690770, rs28937883, rs80356530, rs121908375, rs1480243085, rs397515359, rs267606739, rs397515360, rs74315396, rs730880273, rs119489105, rs371956016, rs104894492, rs104894493, rs28937873, rs121912631, rs62637014, rs137853005, rs137853006, rs62635656, rs62635654, rs28939720, rs137853137, rs62636291, rs62636275, rs62638214, rs62638624, rs104894082, rs869320726, rs80358322, rs80358312, rs28939709, rs72664233, rs796051866, rs121918358, rs141659620, rs111033570, rs121909074, rs121909076, rs1581742970, rs104894672, rs61748436, rs104894673, rs2123743692, rs61750415, rs201578674, rs61751408, rs61749438, rs61750061, rs61750064, rs61751374, rs61748548, rs61750200, rs121909205, rs61750130, rs61752410, rs387906387, rs61751383, rs121909206, rs61753033, rs267607077, rs62638191, rs62638193, rs111033593, rs104894374, rs121434491, rs796051871, rs397515379, rs121917851, rs104893967, rs121434631, rs61750172, rs61750173, rs104893612, rs104893613, rs104893614, rs104893615, rs104893616, rs104893617, rs137852608, rs104893619, rs104893620, rs104893621, rs199476104, rs199476112, rs61752063, rs61752067, rs104894928, rs104894933, rs104894930, rs61752068, rs62638634, rs606231180, rs606231181, rs28933687, rs104894927, rs104894878, rs104894880, rs132630264, rs587776746, rs132630266, rs122456134, rs28934610, rs104895317, rs113624356, rs137853300, rs587776778, rs777094000, rs104893768, rs29001566, rs29001637, rs28933394, rs104893769, rs104893771, rs104893772, rs104893773, rs104893779, rs104893776, rs104893777, rs28933993, rs104893775, rs104893778, rs104893780, rs104893787, rs104893783, rs104893786, rs104893782, rs104893790, rs104893791, rs104893793, rs104893794, rs104893795, rs137853290, rs28933990, rs137853291, rs121918579, rs730880317, rs121918581, rs61752895, rs61752871, rs121917745, rs61755806, rs121918563, rs61755793, rs61755792, rs61748429, rs61755816, rs61755798, rs121918565, rs61755769, rs61755786, rs61755771, rs121918567, rs61755783, rs121912550, rs121912552, rs62625014, rs121912884, rs80356555, rs121434542, rs80359870, rs193302848, rs193302849, rs387906646, rs121909835, rs61749433, rs61751399, rs387906836, rs387906837, rs374390376, rs786200928, rs201391050, rs373909351, rs140287375, rs148374859, rs483352908, rs140511594, rs387907136, rs770066665, rs376586707, rs387907268, rs142968179, rs150726175, rs387907294, rs200311463, rs149648640, rs747425652, rs387907314, rs199476198, rs199476187, rs199476189, rs199476190, rs207482233, rs199476197, rs62645748, rs786205121, rs140256288, rs201153410, rs397516281, rs111033180, rs397516295, rs111033233, rs199897298, rs111033214, rs111033178, rs111033403, rs111033181, rs397516308, rs111033182, rs111033276, rs397516317, rs111033215, rs397516323, rs111033192, rs397516326, rs111033486, rs111033284, rs111033285, rs367928692, rs370983472, rs371981035, rs397517964, rs369522997, rs111033379, rs111033264, rs202175091, rs111033265, rs397517973, rs397517976, rs397517978, rs151148854, rs111033518, rs397517983, rs397517984, rs111033417, rs397517990, rs397517994, rs111033273, rs397518011, rs397518014, rs375668376, rs397518021, rs397518022, rs111033386, rs111033280, rs397518036, rs397518039, rs397518041, rs397518043, rs397518048, rs73090721, rs111033263, rs386833612, rs386833697, rs386833728, rs386833749, rs386834148, rs386834153, rs786200944, rs398122391, rs386834239, rs199469697, rs267598278, rs267601099, rs398122960, rs398122525, rs398122991, rs369037463, rs61750120, rs61752435, rs1800728, rs398123339, rs398123538, rs398123575, rs398123576, rs372504780, rs398124544, rs398124618, rs398124619, rs431905521, rs104895298, rs104895316, rs61749679, rs61750161, rs61750168, rs61750183, rs61750185, rs61749669, rs61755778, rs61755780, rs61755781, rs61755784, rs61755785, rs61755787, rs62645929, rs62645931, rs281865372, rs61755800, rs61755801, rs61755803, rs61755805, rs61755810, rs61755814, rs61755815, rs62645935, rs61755766, rs281865373, rs61748430, rs61748433, rs281865301, rs62635001, rs62635002, rs62653029, rs62635009, rs62638627, rs62638626, rs62638642, rs281865297, rs62638648, rs62650218, rs62640583, rs62640592, rs281865295, rs61751276, rs61751281, rs62636295, rs62636299, rs61752873, rs281865285, rs62642584, rs61752877, rs62642582, rs61751279, rs61752906, rs62645885, rs62645889, rs61750457, rs61752062, rs61752065, rs61752071, rs61752072, rs61752145, rs281865335, rs62645879, rs61752156, rs61752158, rs61752159, rs61753164, rs281865348, rs61753170, rs61753171, rs61753174, rs281865352, rs281865354, rs281865355, rs281865356, rs281865357, rs281865358, rs281865359, rs281865361, rs281865362, rs281865365, rs281865364, rs281865367, rs281865368, rs281865369, rs61748547, rs63749083, rs62642569, rs61748550, rs61751410, rs61752391, rs61748552, rs61748523, rs61748556, rs150774447, rs61748558, rs61748559, rs61751385, rs61751393, rs55732384, rs61749409, rs61749410, rs61749412, rs61751394, rs61749414, rs61749415, rs61749418, rs61752401, rs61751263, rs62654395, rs61749420, rs201738997, rs61749422, rs62654397, rs61749423, rs61749425, rs61751412, rs61748526, rs61749428, rs61751395, rs61750202, rs61749436, rs61752406, rs61749444, rs61749446, rs61748529, rs61749448, rs61749449, rs61749450, rs61749451, rs61749453, rs61752411, rs62645948, rs61748530, rs61751413, rs61749456, rs61751262, rs61749459, rs61751397, rs61750062, rs61752415, rs61750065, rs61748531, rs61751398, rs61752416, rs61752417, rs62645946, rs61752419, rs61750121, rs1801269, rs61752421, rs61752423, rs61752425, rs281865514, rs61751400, rs61752427, rs61752428, rs62642573, rs61750137, rs61750139, rs61754044, rs61750138, rs61750140, rs61750141, rs61750142, rs61752434, rs61750145, rs61750146, rs61750147, rs61751402, rs281865377, rs62646861, rs61750152, rs62642574, rs62645957, rs61750153, rs61750155, rs61752438, rs61752439, rs61751403, rs61750562, rs62646872, rs61750564, rs61753021, rs61750566, rs61750567, rs61751377, rs61751405, rs61750569, rs61753028, rs61750571, rs61750573, rs61751406, rs61750574, rs61753029, rs61753030, rs62642562, rs62642576, rs61750633, rs62642579, rs61748534, rs61751407, rs61753032, rs61751389, rs61753036, rs61750639, rs61753037, rs61748517, rs61750641, rs61750643, rs61753038, rs61750644, rs61750645, rs281865382, rs61750648, rs62642565, rs61750649, rs61748520, rs61750651, rs61753043, rs61750652, rs61750653, rs61750654, rs61751384, rs63749058, rs61748538, rs61751409, rs61753045, rs61753046, rs63749055, rs61750659, rs62645958, rs62646864, rs62645944, rs61748545, rs61751418, rs62636512, rs281865516, rs62636511, rs281865168, rs281865171, rs281865529, rs281865204, rs281865221, rs281865224, rs281865206, rs281865227, rs281865228, rs281865230, rs281865209, rs281865236, rs200277476, rs281865238, rs281865239, rs281865244, rs281865246, rs281865247, rs137853905, rs281865213, rs281865214, rs281865215, rs281865216, rs281865250, rs281865253, rs281865255, rs1805143, rs281865257, rs281865258, rs281865218, rs1805144, rs281865259, rs281865261, rs281865262, rs281865265, rs281865269, rs281865271, rs281865277, rs62637025, rs281865194, rs62640580, rs62640570, rs62636266, rs62636271, rs62636273, rs62636276, rs281865174, rs62645752, rs137853907, rs137853923, rs377177061, rs202210819, rs587777377, rs199882533, rs587777599, rs527236091, rs527236088, rs527236090, rs527236097, rs527236098, rs527236129, rs148460146, rs527236048, rs527236101, rs527236100, rs527236062, rs527236056, rs527236092, rs527236065, rs527236068, rs527236069, rs527236066, rs527236076, rs527236067, rs527236082, rs372989281, rs527236116, rs201493928, rs527236105, rs527236083, rs527236113, rs527236086, rs199867882, rs527236099, rs114342808, rs527236139, rs527236137, rs527236127, rs527236124, rs527236126, rs527236123, rs55958016, rs587777694, rs587783009, rs587783017, rs713993049, rs727504551, rs727505116, rs727503731, rs146733615, rs727503715, rs727505343, rs727503723, rs376764423, rs727504075, rs782252317, rs797044513, rs797044516, rs150232843, rs730882143, rs730882261, rs142422525, rs746523071, rs786204428, rs61750423, rs372006750, rs786204762, rs373862340, rs773372519, rs786204444, rs786204701, rs786204761, rs750228923, rs749909863, rs786205148, rs748902766, rs786205445, rs2723341, rs786205493, rs368098126, rs786205579, rs786205626, rs786205652, rs750542962, rs863223339, rs779007169, rs201422368, rs786205664, rs786205663, rs746559651, rs786205665, rs786205662, rs786205661, rs794726979, rs794727001, rs794727006, rs794727120, rs794727139, rs794727197, rs797044676, rs754012367, rs373441420, rs761238771, rs775557680, rs794727579, rs377311148, rs794727631, rs794727640, rs201657446, rs372347027, rs758329611, rs797044761, rs148660051, rs779791079, rs753330544, rs796065331, rs199946797, rs794729650, rs373273223, rs781192528, rs534542684, rs386833744, rs886041039, rs746174328, rs797045089, rs752683070, rs774122562, rs376306240, rs368049814, rs797045228, rs770558150, rs772624348, rs200692438, rs772136379, rs863224941, rs759781200, rs771214648, rs370483961, rs869025207, rs777668842, rs753874898, rs371525247, rs749439750, rs780624853, rs727503855, rs863225212, rs201541131, rs80358295, rs80358284, rs869312182, rs869312180, rs869312186, rs869312184, rs869312188, rs869312183, rs869312181, rs869312187, rs869312185, rs200460601, rs768933093, rs879255593, rs869320709, rs749012133, rs762951570, rs869320785, rs760225886, rs766590491, rs876657731, rs397517963, rs876657718, rs876661298, rs775177930, rs886044764, rs886044761, rs886044759, rs886044758, rs752147871, rs886044756, rs142253670, rs886044754, rs886044753, rs886044752, rs760549861, rs886044750, rs886044749, rs886044747, rs886044732, rs886044746, rs759672616, rs886044745, rs568792949, rs886044742, rs200967229, rs886044741, rs886044740, rs746541266, rs886044738, rs886044737, rs886044736, rs768278935, rs1047376, rs756840095, rs886044731, rs886044735, rs201471607, rs61749441, rs746566873, rs61749427, rs766570903, rs886044730, rs61752398, rs886044728, rs886044727, rs886044726, rs886044725, rs765707028, rs61752390, rs886044722, rs886044721, rs886044720, rs886044719, rs778908435, rs878853366, rs878853364, rs767648174, rs878853371, rs878853367, rs878853369, rs746837034, rs368675850, rs878853407, rs878853413, rs878853414, rs878853411, rs878853405, rs758705873, rs878853404, rs878853408, rs765293412, rs878853410, rs878853372, rs878853397, rs878853396, rs878853355, rs878853354, rs878853353, rs750151209, rs201186440, rs761440783, rs757470958, rs878853359, rs878853357, rs878853358, rs768660614, rs878853379, rs878853352, rs878853351, rs878853400, rs762078182, rs372513650, rs199584830, rs878853348, rs878853350, rs878853349, rs143994166, rs878853382, rs746359399, rs557432569, rs769156393, rs878853327, rs878853329, rs878853328, rs878853326, rs751788879, rs878853337, rs878853347, rs878853378, rs878853376, rs781112960, rs878853361, rs878853362, rs747835249, rs371496675, rs878853360, rs878853363, rs878853392, rs878853391, rs878853390, rs577932201, rs878853389, rs878853341, rs878853338, rs878853339, rs878853385, rs377031435, rs760430056, rs878853394, rs878853387, rs878853342, rs878853383, rs878853331, rs878853335, rs878853334, rs868538598, rs878853374, rs878853381, rs867451420, rs764256655, rs751130485, rs886039450, rs886039449, rs145961131, rs757557272, rs552069173, rs139027297, rs765998048, rs886039311, rs748810737, rs886039867, rs748706582, rs886041040, rs886041502, rs886041951, rs748394238, rs886041233, rs367877017, rs886041141, rs780225183, rs886041142, rs769035379, rs753353134, rs886041176, rs886041179, rs886041177, rs886041376, rs886041178, rs758109813, rs760165634, rs750396156, rs749526785, rs371777049, rs886043023, rs776256380, rs773539640, rs776740276, rs575453437, rs201855602, rs886044148, rs886044302, rs770748359, rs753018563, rs779426136, rs200094982, rs141563823, rs770218590, rs752953889, rs886063161, rs199877211, rs749199721, rs1057517533, rs536593247, rs758921360, rs1057517251, rs1057516451, rs376894444, rs746875134, rs147030232, rs1057517692, rs1057517844, rs374536346, rs116471343, rs865990202, rs61752902, rs387906385, rs1057517869, rs1057517700, rs543698823, rs752179149, rs1057517857, rs1057517982, rs62645894, rs1057517715, rs1057518922, rs1057518955, rs775796581, rs1057518793, rs368088025, rs1057519165, rs1057519193, rs556788423, rs1057519342, rs1057520152, rs759898765, rs397517979, rs199840367, rs61750638, rs779466403, rs760790294, rs1057520213, rs371489809, rs1057521112, rs763797356, rs1057521475, rs766246531, rs1060499783, rs747656448, rs745340459, rs1166022838, rs775950661, rs375413604, rs1064793289, rs200712760, rs137954284, rs1064793014, rs762150575, rs141823837, rs1064793006, rs769317780, rs559155109, rs753925314, rs769671323, rs199740930, rs1064794848, rs771898125, rs775283269, rs1064794012, rs763762899, rs139842473, rs777849213, rs112005636, rs1064797133, rs1064797134, rs770011113, rs1064797247, rs777497868, rs773065850, rs1064797365, rs1064797368, rs752159903, rs866978361, rs1085307968, rs1375507464, rs772725807, rs201320564, rs776896038, rs764742792, rs1554612159, rs62645747, rs753886165, rs753614067, rs140451304, rs555164150, rs539192853, rs766379510, rs281865531, rs369523378, rs1553192715, rs72664214, rs72653787, rs1473611414, rs1455470131, rs752762669, rs369775002, rs145282040, rs773914330, rs1553263218, rs1003869920, rs1553252388, rs762159022, rs751111524, rs746551311, rs780308389, rs199683808, rs1553186896, rs1297857869, rs776757706, rs778234759, rs1435203678, rs1553188588, rs1553188682, rs1553189507, rs1553190559, rs1553190664, rs1553192432, rs1553192682, rs1553192726, rs1553193813, rs764759172, rs1356104318, rs541717028, rs111733491, rs1553512879, rs1553513437, rs569826109, rs367658438, rs750987123, rs1553403585, rs754995805, rs758291149, rs1553711564, rs1553780837, rs373331232, rs780697796, rs370898371, rs753942596, rs144484128, rs146591309, rs777309662, rs1554186385, rs1554269053, rs1554270834, rs181169439, rs1554183440, rs930421180, rs1554214453, rs760798455, rs764163418, rs866395428, rs765129639, rs1554519555, rs1449723475, rs1554519651, rs769601671, rs977790637, rs1554857529, rs756678484, rs1554824273, rs906525288, rs1555036138, rs1555037395, rs1555096248, rs1555099048, rs531851447, rs1199012623, rs766096417, rs377257254, rs199830550, rs756806434, rs1352458826, rs189234741, rs752997229, rs771450991, rs1555792415, rs1555811525, rs758316679, rs748531024, rs778612831, rs1555870809, rs749009747, rs1555874538, rs1555961832, rs1555961852, rs1556318633, rs1557106557, rs1555955061, rs1554998040, rs1554628460, rs1461319754, rs770390524, rs1553901823, rs1347914291, rs1554519822, rs555421894, rs1556297584, rs1556300610, rs1556300621, rs1554264613, rs758052634, rs775836730, rs1555208870, rs1409688898, rs763371769, rs1554186463, rs779450345, rs778606847, rs754768875, rs765429911, rs1272411609, rs1349849938, rs1002670900, rs1553781140, rs373792616, rs200335504, rs1369414978, rs1366496013, rs1555202584, rs567573386, rs1365490247, rs141386891, rs534534437, rs769838859, rs1201940872, rs753090404, rs138958917, rs761469964, rs1460604134, rs748357067, rs1429786931, rs201730567, rs1553187162, rs1553188071, rs765063151, rs780910490, rs143344549, rs866982675, rs769215629, rs752521456, rs1553189179, rs751176116, rs1244761864, rs765402802, rs782077721, rs143745703, rs201823777, rs1553188916, rs1309140887, rs1431752515, rs1554963305, rs1555965107, rs142285818, rs1307312865, rs1554269081, rs769512989, rs1555225566, rs1553196583, rs951379922, rs1554963058, rs1555200648, rs1555550617, rs1555968248, rs1555098634, rs199636364, rs768161313, rs1553252499, rs1177257719, rs200871041, rs757676723, rs747160949, rs764917754, rs1295968274, rs764182950, rs747063294, rs367674026, rs779572631, rs1553257707, rs746447649, rs1431048303, rs749452910, rs1553273330, rs779716464, rs1485173724, rs1553261372, rs1553250150, rs1553299079, rs199782530, rs370327669, rs199982344, rs1553261479, rs988693758, rs760302201, rs1553271001, rs1553313810, rs770383273, rs993185407, rs483353054, rs780779563, rs1553270960, rs775293551, rs754374132, rs1553272176, rs745350407, rs756623509, rs767078782, rs1342455785, rs1177198729, rs372927796, rs748961218, rs771583281, rs1188025733, rs868562952, rs1553250952, rs758303489, rs1484339054, rs781223647, rs1187839124, rs767414973, rs1225343345, rs761292021, rs754702823, rs1553409710, rs1476205467, rs1553421626, rs1553941304, rs1326370032, rs1427770112, rs528919874, rs750840208, rs752736741, rs1165454778, rs751629543, rs1554537807, rs747240928, rs143842048, rs1052030, rs1472566324, rs1555067667, rs1156913215, rs760693838, rs1555454566, rs1555521379, rs1273181642, rs1367927635, rs544773389, rs773862084, rs1555520142, rs764164384, rs779690256, rs750506474, rs878962682, rs116733939, rs1565083843, rs748983904, rs1457937638, rs1189889920, rs746141070, rs868349465, rs1562140604, rs1563329888, rs1563983151, rs776289402, rs1566561006, rs777989874, rs750740765, rs574936510, rs771551785, rs1569235803, rs1569237206, rs370210428, rs1280238814, rs1563366896, rs747914869, rs756310864, rs772170760, rs757823463, rs138011813, rs753884599, rs988133284, rs868732642, rs1557783989, rs1562846257, rs1558251742, rs281865520, rs61750171, rs755733328, rs1471994744, rs758660532, rs1557787756, rs970990957, rs1190307769, rs1569237077, rs752263228, rs971610277, rs775957498, rs1557918635, rs1557918544, rs1565653781, rs552517556, rs777215595, rs1562434099, rs373203896, rs772917364, rs374410829, rs776727320, rs1559643320, rs751290509, rs772057239, rs779983752, rs1562220891, rs778977288, rs377267777, rs777069665, rs145719998, rs1557767754, rs530749007, rs150412614, rs759662695, rs777878533, rs377029071, rs1000861056, rs781705903, rs201863550, rs771000800, rs1571241930, rs1571241947, rs2297669, rs886039299, rs772421550, rs959069360, rs768210562, rs766357803, rs61755811, rs1582780550, rs74419361, rs1585557752, rs1585567204, rs1225032182, rs281865263, rs368489658, rs759339012, rs1595956595, rs1365926616, rs758001091, rs1598146589, rs776004321, rs1601943268, rs754970095, rs745654673, rs1578097528, rs781377291, rs1581211727, rs968692633, rs1600340117, rs1571264574, rs1570377861, rs1302809734, rs536742386, rs769742202, rs185225547, rs752939204, rs748798324, rs751823180, rs770329105, rs774130993, rs775699005, rs1225304963, rs371032798, rs745656125, rs111033477, rs1294402003, rs759408031, rs200387832, rs776204925, rs758899480, rs746351112, rs1562408256, rs751413984, rs769723975, rs374258471, rs1571158279, rs1571134523, rs778114016, rs561075447, rs1571783742, rs759433119, rs1373168392, rs1571243037, rs1232476760, rs1571257754, rs1571258440, rs1571265125, rs61751401, rs1571265241, rs1570367230, rs1401924846, rs1557787473, rs1366296798, rs761209432, rs746291728, rs1578281565, rs745704627, rs765376986, rs769824975, rs376500610, rs888090139, rs764232082, rs1601917999, rs1601974881, rs761460379, rs111033408, rs1571703801, rs774475956, rs1208195953, rs752619497, rs755429480, rs375548374, rs1600335148, rs1254494198, rs1582929649, rs1571848744, rs1571540258, rs368687374, rs1437993640, rs779743222, rs774215025, rs763272975, rs1585563283, rs1587620892, rs776634113, rs1592521438, rs1592521712, rs1592784618, rs1420750126, rs1594867516, rs281865302, rs890453675, rs1577301137, rs1581735836, rs1656419435, rs1386612395, rs1660298900, rs2039692173, rs1659430629, rs1659900155, rs1661098509, rs1661577361, rs751644763, rs1734066547, rs1737442897, rs1761021773, rs1800111659, rs986748364, rs1488052513, rs1766367970, rs1300490966, rs368159852, rs886210482, rs1806033844, rs1806128576, rs748084580, rs1942169028, rs745934202, rs1400806789, rs1257334132, rs2073964950, rs1314226094, rs1927824776, rs2067124487, rs2067127275, rs1854473658, rs1601943325, rs2067985165, rs2067987832, rs1924521431, rs1662216783, rs1571801788, rs1594280740, rs34713174, rs1197863938, rs1278603247, rs778645644, rs766357080, rs1039053911, rs768445391, rs767729255, rs1570373408, rs747950242, rs151141842, rs369184026, rs768713412, rs1657798642, rs1424639717, rs769609970, rs201529124, rs369973540, rs1306732480, rs1368508052, rs1660843703, rs542919944, rs1661575232, rs1005271380, rs1191816747, rs375110174, rs188492864, rs769632183, rs753107507, rs748396645, rs2063883437, rs749842881, rs201782746, rs771980888, rs759184240, rs2084776162, rs142771862, rs368213921, rs772867912, rs145605739, rs760042062, rs1372091680, rs1745312538, rs754916169, rs1355690902, rs1336317768, rs1299355731, rs184722374, rs1245304444, rs1389794536, rs780433094, rs1388177618, rs748370008, rs767005321, rs1231321479, rs1806041389, rs1365908727, rs761969118, rs927241903, rs1844909478, rs28940275, rs775791299, rs111033187, rs778934538, rs2033943937, rs1033594764, rs535922252, rs745741473, rs138370992, rs759505780, rs76076446, rs749738655, rs1968169319, rs1270675463, rs1386256334, rs1924904597, rs2065670611, rs1659900228, rs529598960, rs777673930, rs1228475082, rs1772614934, rs201086679, rs748946491, rs767630412, rs144169488, rs746128841, rs1174120641, rs199537336, rs767366723, rs1767600988, rs1769267226, rs1955083613, rs1826338661, rs1657981991, rs1658082808, rs1658656722, rs1167867158, rs1660515780, rs1664290387, rs866822473, rs963201816, rs1664325377, rs1664643556, rs766411096, rs1664671663, rs1426006136, rs1558138741, rs1665100409, rs1665102146, rs1450635782, rs760544654, rs1216093309, rs1656416727, rs1656646221, rs1656901821, rs1657796004, rs1657799720, rs1419913594, rs1485393201, rs755480221, rs1657961646, rs1657976232, rs1657992342, rs1657997730, rs1658179729, rs1659887829, rs762070900, rs1660922779, rs1661140054, rs1661687852, rs1662771528, rs1558121260, rs1663836291, rs1664810877, rs1665132445, rs1665453379, rs755032078, rs2032220940, rs2032459600, rs769198746, rs2034687946, rs2034852728, rs2035704899, rs2036051613, rs2036054600, rs2036066604, rs757154662, rs2037018431, rs766370703, rs2037679829, rs757525434, rs2038566220, rs1195779037, rs2038568675, rs2039690812, rs1643875847, rs1645824260, rs562037932, rs886042220, rs1444234037, rs779585931, rs1659061509, rs62642580, rs1362964563, rs1242866408, rs1659430143, rs1659452428, rs757449019, rs1659538743, rs1659721337, rs1659840790, rs763911476, rs751844313, rs1340989734, rs1659953619, rs1660137001, rs61750148, rs1660166963, rs1046550021, rs1283350532, rs1660480045, rs1660481072, rs373868915, rs1237125868, rs1660532299, rs757302286, rs1661162346, rs1661163134, rs374224955, rs1448468321, rs1661625047, rs1661663692, rs1661669685, rs868543294, rs1641704371, rs771336246, rs1684627892, rs1684979540, rs1252719064, rs774755041, rs1676904823, rs775776288, rs746238212, rs1278226911, rs1238123416, rs1689010156, rs1689011389, rs200711686, rs1685573282, rs1668402514, rs1366937730, rs761147595, rs1182748194, rs1558488513, rs1667504255, rs1667506537, rs1196801124, rs753619551, rs1558490060, rs866543181, rs762973163, rs1270472063, rs1205704532, rs1671925979, rs774594040, rs748709116, rs749339938, rs1315351235, rs541559170, rs1672973685, rs1674967197, rs1412574975, rs376091780, rs556400279, rs2063893838, rs2063918440, rs2078763986, rs2078764558, rs1692508715, rs761554853, rs762668060, rs943314733, rs1227761587, rs1692915919, rs779023431, rs1692928194, rs1692930941, rs201747279, rs183838250, rs779626652, rs1706422873, rs1706423076, rs1706423758, rs771246451, rs1706439944, rs770399625, rs1472199114, rs1706473340, rs1706474422, rs1706627397, rs1706755871, rs746003280, rs1706843510, rs764109533, rs149079952, rs2084757329, rs1415160298, rs1578278438, rs104893788, rs2084785435, rs1560046837, rs1402468701, rs1578280588, rs984572250, rs1578281706, rs2084801700, rs1235835151, rs1715594024, rs1732788163, rs778059585, rs762782183, rs974173261, rs1560708847, rs1328767121, rs1718726537, rs761152494, rs1743846367, rs369063468, rs775749608, rs768694789, rs1738673948, rs1738698692, rs369717052, rs1237954156, rs767438881, rs1734075026, rs1735848896, rs1736334634, rs761619791, rs747970185, rs1737428529, rs1737429976, rs373037737, rs1737503567, rs746552548, rs759563967, rs1754021035, rs1760621228, rs1746018557, rs1185617030, rs1748947002, rs1292664749, rs1754556067, rs1755688091, rs778188580, rs1758488956, rs1764301206, rs1364707671, rs1784887448, rs781198326, rs1770116834, rs751589956, rs766181526, rs774204108, rs760829254, rs1305999116, rs1331834680, rs1768016995, rs1799985749, rs1799986608, rs1799988458, rs1800110629, rs1800110757, rs1800110798, rs1458793437, rs1800111486, rs61755813, rs1442844778, rs779414078, rs61755794, rs1242862941, rs1761921113, rs1409801782, rs1768346880, rs772549804, rs1768389030, rs1431427428, rs1770904723, rs1774743530, rs1766383947, rs909730457, rs1766404452, rs1767312015, rs1767601715, rs1245121527, rs1767699695, rs1295206142, rs548565748, rs1768657480, rs1765727233, rs1765728504, rs1766556883, rs746499646, rs1766006937, rs1766009155, rs1375767063, rs1459031771, rs779372264, rs986664547, rs1769692830, rs1769707298, rs1793956441, rs1798216037, rs1784156837, rs763759470, rs1797868307, rs749460193, rs371886218, rs1797910388, rs1806020324, rs1806033441, rs1806036718, rs1806037949, rs1488237523, rs1806043158, rs1230883512, rs1806057300, rs779290365, rs746396730, rs1806079331, rs373109791, rs1806160527, rs1822989898, rs202036979, rs141099767, rs1819778559, rs751600925, rs763785730, rs1819787095, rs754275640, rs1819797791, rs1821068883, rs776271026, rs1363491382, rs1042726781, rs1363359148, rs781881541, rs1861132418, rs1865149889, rs1866696630, rs754876029, rs1841315122, rs1841460358, rs1842189258, rs760608593, rs1842324166, rs1844615558, rs1844944116, rs2058399145, rs1403661741, rs746820022, rs1236291370, rs2058673701, rs2041025786, rs1243587288, rs1850697098, rs1850741468, rs1209208472, rs1382219910, rs980876322, rs762398929, rs1942208203, rs1856478505, rs1856787758, rs1856790811, rs775166854, rs2098614719, rs2098676296, rs2098677212, rs782639389, rs1953075862, rs1954927143, rs749747871, rs780609120, rs375135224, rs2033241849, rs2033937635, rs748471942, rs1345994179, rs2037229663, rs762633090, rs774490795, rs769102771, rs1882854195, rs1882945917, rs1883031542, rs1739469293, rs768178406, rs747257567, rs761167763, rs1163040913, rs2038196341, rs140257538, rs760813820, rs751589863, rs766173950, rs779740894, rs769845921, rs2034398158, rs2034427266, rs200047855, rs2074443699, rs1566947860, rs1489149705, rs955766374, rs2054237722, rs2065896039, rs766675673, rs561618945, rs762111572, rs2033706353, rs2034681207, rs2034747055, rs762817061, rs2035847573, rs2046158549, rs1451575280, rs756885471, rs1210263161, rs1960899756, rs1468272829, rs1157108621, rs1193604660, rs121434239, rs1911391944, rs773201535, rs1975949139, rs769818541, rs104894671, rs1968162133, rs1968165008, rs1968165080, rs1968169004, rs1968170098, rs2073701307, rs2073708846, rs2073709089, rs2073817463, rs2073817965, rs2073854068, rs2073855020, rs2073873693, rs2073875313, rs2073876392, rs2073926924, rs2073964314, rs1342475527, rs2073970078, rs2073970450, rs2074043162, rs2064852005, rs759131391, rs2067513100, rs775124094, rs890128759, rs2088652401, rs1300228825, rs2089115544, rs752395624, rs756223600, rs1925733148, rs1927703176, rs1927819239, rs1928220547, rs1928222017, rs2067114709, rs2067117239, rs866524368, rs1186795749, rs2067127718, rs1569235565, rs2067136586, rs2067140471, rs1569235999, rs2067144007, rs2067146007, rs1555961509, rs2067157388, rs2067160273, rs2067161139, rs2067163605, rs2067164096, rs2067169164, rs2067169934, rs2067170858, rs2067172824, rs2067174697, rs1233849070, rs2067175855, rs2067176160, rs2067176379, rs1373833359, rs2067182354, rs2067182636, rs2067182990, rs2067183162, rs2067184023, rs2067185564, rs2067186632, rs2067186762, rs2067187127, rs2067187550, rs2067187618, rs2067188031, rs2067188111, rs2067190364, rs2067190922, rs2067191154, rs2067191335, rs2067191635, rs1305342570, rs2067193056, rs2067194648, rs1569237670, rs2067196140, rs2067201139, rs2067217398, rs2067217662, rs2067217874, rs2067218363, rs2067267431, rs2067277129, rs2067406342, rs2067449854, rs2067451355, rs62642057, rs2067700774, rs2067877357, rs2067878321, rs2067878443, rs2067976665, rs2067985696, rs2064376489, rs2064378728, rs1924521211, rs1924895234, rs1924896735, rs1924897230, rs1924901288, rs1924904407, rs1925035229, rs2065644808, rs2065701414, rs2065717735, rs2065740868, rs2065833366, rs2065833777, rs1244003380, rs1926202704, rs1926208067, rs1926208868, rs1929999634, rs1930006988, rs1930414140, rs1930421028, rs1930424797, rs1930435879, rs1930445401, rs1934694621, rs762837543, rs1927017073, rs1649583816, rs1292874452, rs1654722914, rs760287363, rs1664686689, rs1665282720, rs1235430504, rs1371160062, rs1661818720, rs2031604509, rs1558244152, rs2034951427, rs2037617658, rs912980910, rs2037658254, rs756111113, rs1658918693, rs759513613, rs61750156, rs1659914923, rs751319688, rs1659997092, rs1168144507, rs544428779, rs1662599697, rs1677289241, rs1687854945, rs1005130980, rs1334444660, rs1560664459, rs1577845276, rs1722845773, rs1472802723, rs898144119, rs1383907349, rs781616522, rs369896113, rs1753232409, rs1751572548, rs769286352, rs1761904690, rs1768621810, rs1769469813, rs1826145876, rs1951414426, rs1402893508, rs764824311, rs1865145294, rs769524849, rs1280991447, rs762805265, rs1841921374, rs547198427, rs2058440863, rs1941247515, rs1941898895, rs1856202628, rs1856699646, rs1956849074, rs1957972028, rs1939312423, rs1399741348, rs752197734, rs2035880971, rs2038012556, rs760391688, rs2054201689, rs2065735740, rs748523056, rs2034739931, rs1961362638, rs2073798309, rs2073871791, rs2073961843, rs2073971858, rs752137434, rs2035758739, rs1928365871, rs1928241490, rs2067453631, rs1924915809, rs1925389524, rs782557600, rs2065753439, rs1924181543, rs1930090887, rs1603263147, rs1931625021, rs1934693393, rs748680704, rs765070399, rs765676754, rs1366609497, rs1657036615, rs1467000353, rs1667513233, rs1167380267, rs2084786704, rs1295259849, rs1819778622, rs374517178, rs368984997, rs2040644756, rs775073228, rs148045000, rs2067140574, rs2067148119, rs2067179633, rs2067190976, rs2067200470, rs2067498092, rs1924193863 |
|
Schizophrenia |
Schizophrenia |
rs74315508, rs74315509, rs13447324, rs1558507406, rs387906932, rs387906933, rs863223354, rs863223355, rs776061422, rs863223349, rs748809996, rs759748655, rs863223353, rs863223350, rs863223356, rs781821239, rs863223348, rs863223346, rs863223347, rs863223351, rs863223352, rs61734270, rs797045205, rs869312829, rs869312830, rs770913157, rs869312832, rs869312831, rs781720548, rs1262969313 |
20087814, 22505994 |
Seizure |
Tonic - clonic seizures |
rs587784365, rs28939683, rs74315390, rs28939684, rs74315391, rs267607198, rs74315392, rs118192244, rs118192250, rs121917749, rs121917750, rs121917751, rs121917752, rs267606670, rs267607061, rs121912707, rs118192249, rs118192251, rs118192217, rs118192218, rs118192219, rs118192222, rs118192226, rs118192228, rs118192234, rs118192236, rs118192235, rs118192241, rs118192242, rs118192185, rs118192188, rs118192245, rs118192246, rs118192186, rs118192194, rs118192197, rs118192199, rs118192201, rs118192202, rs118192203, rs118192204, rs118192205, rs118192206, rs118192208, rs118192211, rs118192216, rs118192239, rs387906684, rs387906686, rs387906687, rs1596893185, rs387907126, rs387907281, rs397515405, rs587778771, rs730882067, rs730882073, rs397514579, rs397514582, rs587776976, rs398122394, rs121918784, rs121918751, rs121918735, rs398123588, rs587780450, rs61749751, rs587777620, rs727503974, rs730882124, rs794726710, rs794726697, rs794726799, rs794727444, rs794727740, rs796053166, rs794726825, rs796052676, rs796053219, rs796053220, rs796053228, rs796052653, rs759584387, rs796052650, rs796052641, rs796052626, rs796052623, rs796052663, rs796052615, rs796052802, rs797044999, rs797045047, rs797045942, rs797045941, rs118192212, rs797044938, rs777257591, rs864321712, rs879255652, rs886039268, rs886039517, rs886039529, rs199497486, rs886039496, rs886039903, rs886041300, rs769827124, rs886041339, rs886041591, rs587783092, rs1555850151, rs1057516123, rs1057516121, rs1057516115, rs1057516111, rs1057516106, rs1057516105, rs756921902, rs1057516089, rs1057516087, rs1057516080, rs1057516076, rs1060499544, rs1555850512, rs1057517919, rs118192231, rs1057520413, rs1060503101, rs1064796294, rs1064794981, rs1064794632, rs1064797245, rs1131691830, rs1131692231, rs1131691936, rs1554626549, rs1553579225, rs1553531385, rs121918736, rs1554898088, rs1553579282, rs763353895, rs1553463119, rs1554093891, rs77838305, rs1555408401, rs1554627439, rs1554097873, rs1555850403, rs1064794719, rs1315483224, rs1567134495, rs770187706, rs1057518555, rs1576983339, rs1574192005, rs1459374430, rs1586800133, rs1574641522, rs1572096837, rs1572630269, rs1574554892, rs1574556643, rs1574571769, rs1574641605, rs1574697769, rs1574716524, rs1574746733, rs1574746935, rs1574752700, rs1574754680, rs863225030, rs1601545088, rs1600714727, rs1371059392, rs1600767259, rs1339542565, rs1600785769, rs2065899210, rs1600732174, rs1162306056, rs879255709, rs1900111672, rs2066910297, rs1554122080, rs796052941, rs1600789325, rs2082695884, rs1737677036, rs1737495759, rs868389022, rs1737685202, rs1737672350, rs762737130 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Abulia |
Abulia |
|
|
Alexia |
Alexia |
|
|
Anomia |
Anomia |
|
|
Anxiety disorder |
Anxiety |
|
|
Aphasia |
Aphasia, Primary Progressive Aphasia (disorder) |
|
|
Behavioral variant of frontotemporal dementia |
Behavioral variant of frontotemporal dementia |
|
23597030, 23392204 |
Bipolar disorder |
Bipolar Disorder |
|
22505994, 24499389 |
Brain atrophy |
Brain atrophy |
|
|
Broca aphasia |
Broca Aphasia |
|
|
Cerebellar atrophy |
Cerebellar atrophy |
|
|
Cerebral atrophy |
Cerebral atrophy |
|
|
Cerebral cortical atrophy |
Cerebral cortical atrophy |
|
|
Compulsive hoarding |
Compulsive hoarding |
|
|
Dementia |
Dementia, Familial Dementia |
|
17436289, 18543312, 18543312, 17436289 |
Disorder of eye |
Disorder of eye |
|
|
Dyscalculia |
Dyscalculia |
|
|
Dysgraphia |
Dysgraphia |
|
|
Dyslexia |
Dyslexia |
|
|
Dysphasia |
Dysphasia |
|
|
Frontotemporal cerebral atrophy |
Frontotemporal cerebral atrophy |
|
|
Grammar-specific speech disorder |
Grammar-specific speech disorder |
|
|
Frontotemporal lobar degeneration with tdp43 inclusions |
FRONTOTEMPORAL LOBAR DEGENERATION WITH TDP43 INCLUSIONS, GRN-RELATED |
|
28264768, 16983685, 16862116, 17334266, 21482928, 23338682, 17202431, 18183624, 16950801, 22608501, 20142524, 27258413, 22647257, 17439980 |
Hallucinations |
Hallucinations |
|
|
Hypersexuality |
Hypersexuality state |
|
|
Mental depression |
Mental Depression, Depressive disorder |
rs587778876, rs587778877 |
20400120, 22895706, 20667979, 20400120, 20667979, 22895706 |
Myoclonic seizures |
Generalized myoclonic seizures |
|
|
Nonfluent aphasia |
Primary Progressive Nonfluent Aphasia |
|
23597030 |
Progressive non-fluent aphasia |
Progressive non-fluent aphasia |
|
|
Psychosis |
Psychotic Disorders |
|
|
Repetitive compulsive behavior |
Repetitive compulsive behavior |
|
|
Semantic dementia |
Semantic Dementia |
|
23597030, 21454553, 22028881 |
Senile paranoid dementia |
Senile Paranoid Dementia |
|
17436289, 18543312 |
Senile plaques |
Senile Plaques |
|
|
Stereotyped behavior |
Stereotyped Behavior |
|
|
Temporal cortical atrophy |
Temporal cortical atrophy |
|
|
|
|
|