PCSK9 (proprotein convertase subtilisin/kexin type 9)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
255738 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Proprotein convertase subtilisin/kexin type 9 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
PCSK9 |
SynonymsGene synonyms aliases
|
FH3, FHCL3, HCHOLA3, LDLCQ1, NARC-1, NARC1, PC9 |
ChromosomeChromosome number
|
1 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
1p32.3 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein under |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs509504 |
A>C,G,T |
Likely-benign, benign, conflicting-interpretations-of-pathogenicity |
Non coding transcript variant, synonymous variant, coding sequence variant, missense variant |
rs7552471 |
C>A,T |
Conflicting-interpretations-of-pathogenicity, likely-benign, benign |
Non coding transcript variant, synonymous variant, missense variant, coding sequence variant |
rs11583680 |
C>G,T |
Pathogenic |
Missense variant, genic upstream transcript variant, upstream transcript variant, coding sequence variant |
rs11800243 |
G>A |
Conflicting-interpretations-of-pathogenicity, likely-benign, benign |
Intron variant |
rs28362201 |
G>C,T |
Uncertain-significance, conflicting-interpretations-of-pathogenicity, likely-benign |
Genic upstream transcript variant, 5 prime UTR variant, upstream transcript variant |
rs28362261 |
A>G |
Benign, benign-likely-benign, likely-benign, uncertain-significance, conflicting-interpretations-of-pathogenicity |
Coding sequence variant, missense variant, non coding transcript variant |
rs28362286 |
C>A,T |
Pathogenic, association, benign |
Stop gained, coding sequence variant, synonymous variant, non coding transcript variant |
rs28362287 |
C>T |
Conflicting-interpretations-of-pathogenicity, likely-benign |
3 prime UTR variant, non coding transcript variant |
rs28385701 |
C>T |
Benign, conflicting-interpretations-of-pathogenicity, likely-benign |
Genic upstream transcript variant, coding sequence variant, synonymous variant, upstream transcript variant |
rs28385710 |
C>T |
Benign-likely-benign, conflicting-interpretations-of-pathogenicity, likely-benign |
Coding sequence variant, synonymous variant, non coding transcript variant |
rs28942111 |
T>A |
Pathogenic, likely-pathogenic |
Coding sequence variant, intron variant, missense variant |
rs28942112 |
T>C |
Pathogenic |
Coding sequence variant, missense variant, non coding transcript variant |
rs35574083 |
GCTGCTGCT>-,GCT,GCTGCT,GCTGCTGCTGCT,GCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCTGCT |
Benign, benign-likely-benign, likely-benign, uncertain-significance, conflicting-interpretations-of-pathogenicity |
Genic upstream transcript variant, coding sequence variant, inframe deletion, inframe insertion, upstream transcript variant |
rs41297883 |
C>A,T |
Benign, conflicting-interpretations-of-pathogenicity, likely-benign |
Coding sequence variant, synonymous variant, non coding transcript variant |
rs67608943 |
C>G,T |
Conflicting-interpretations-of-pathogenicity, association |
Stop gained, synonymous variant, coding sequence variant, intron variant |
rs137852912 |
G>A,C,T |
Pathogenic-likely-pathogenic, pathogenic |
Non coding transcript variant, missense variant, coding sequence variant |
rs146471967 |
C>A |
Likely-benign, conflicting-interpretations-of-pathogenicity |
Missense variant, coding sequence variant, non coding transcript variant |
rs185392267 |
C>T |
Pathogenic |
Coding sequence variant, missense variant, intron variant |
rs374603772 |
C>T |
Conflicting-interpretations-of-pathogenicity, uncertain-significance |
Coding sequence variant, missense variant, non coding transcript variant |
rs569379713 |
C>T |
Pathogenic, uncertain-significance |
Missense variant, intron variant, coding sequence variant |
rs745633457 |
G>A,T |
Pathogenic |
Intron variant |
rs753857795 |
G>A |
Conflicting-interpretations-of-pathogenicity |
Coding sequence variant, non coding transcript variant, missense variant |
rs761767572 |
C>T |
Pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs764603059 |
G>T |
Pathogenic, uncertain-significance |
Upstream transcript variant, missense variant, coding sequence variant, genic upstream transcript variant |
rs768795323 |
G>A |
Uncertain-significance, pathogenic |
Non coding transcript variant, missense variant, coding sequence variant |
rs772677312 |
C>G |
Uncertain-significance, likely-pathogenic |
Non coding transcript variant, missense variant, coding sequence variant |
rs778849441 |
C>A,G,T |
Likely-pathogenic, pathogenic, uncertain-significance |
Coding sequence variant, stop gained, missense variant, non coding transcript variant |
rs793888521 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant, non coding transcript variant |
rs794728683 |
G>A,T |
Pathogenic, likely-pathogenic, uncertain-significance |
Missense variant, coding sequence variant, non coding transcript variant |
rs886039839 |
C>A |
Likely-pathogenic |
Upstream transcript variant, missense variant, coding sequence variant, genic upstream transcript variant |
rs886046435 |
G>A,C |
Pathogenic, uncertain-significance |
Non coding transcript variant, coding sequence variant, missense variant |
rs986151799 |
G>A |
Pathogenic |
Synonymous variant, coding sequence variant, non coding transcript variant |
rs1057519691 |
T>C,G |
Likely-pathogenic, pathogenic |
Missense variant, intron variant, coding sequence variant |
rs1254346075 |
G>A,T |
Pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs1272703401 |
G>A |
Pathogenic |
Intron variant, upstream transcript variant, genic upstream transcript variant |
rs1278890129 |
G>A |
Pathogenic, uncertain-significance |
Upstream transcript variant, coding sequence variant, genic upstream transcript variant, missense variant |
rs1372204035 |
C>G |
Pathogenic |
Coding sequence variant, missense variant, upstream transcript variant, genic upstream transcript variant |
rs1553135400 |
G>A |
Pathogenic |
Upstream transcript variant, coding sequence variant, missense variant, genic upstream transcript variant |
rs1553135406 |
C>- |
Likely-pathogenic, pathogenic |
Upstream transcript variant, frameshift variant, coding sequence variant, genic upstream transcript variant |
rs1553135930 |
A>C |
Pathogenic |
Intron variant, coding sequence variant, missense variant |
rs1553135971 |
A>G |
Likely-pathogenic, uncertain-significance |
Intron variant, coding sequence variant, missense variant |
rs1553137543 |
A>T |
Likely-pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs1553137693 |
A>G |
Pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
rs1553137699 |
G>T |
Pathogenic |
Non coding transcript variant, coding sequence variant, missense variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Transcription factors
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
GO ID |
Ontology |
Definition |
Evidence |
Reference |
GO:0001822 |
Process |
Kidney development |
ISS |
12552133 |
GO:0001889 |
Process |
Liver development |
ISS |
12552133 |
GO:0001920 |
Process |
Negative regulation of receptor recycling |
IDA |
17452316, 22848640 |
GO:0002092 |
Process |
Positive regulation of receptor internalization |
IDA |
17328821 |
GO:0003723 |
Function |
RNA binding |
HDA |
22658674 |
GO:0004252 |
Function |
Serine-type endopeptidase activity |
IBA |
21873635 |
GO:0004252 |
Function |
Serine-type endopeptidase activity |
IDA |
12552133 |
GO:0005515 |
Function |
Protein binding |
IPI |
17461796, 18799458, 22081141, 22493497, 22580899, 22848640, 25613181 |
GO:0005576 |
Component |
Extracellular region |
TAS |
|
GO:0005615 |
Component |
Extracellular space |
IBA |
21873635 |
GO:0005615 |
Component |
Extracellular space |
IDA |
12552133, 16912035, 17080197 |
GO:0005737 |
Component |
Cytoplasm |
IDA |
22580899 |
GO:0005764 |
Component |
Lysosome |
IDA |
17461796, 18039658 |
GO:0005765 |
Component |
Lysosomal membrane |
TAS |
|
GO:0005769 |
Component |
Early endosome |
IDA |
17461796 |
GO:0005770 |
Component |
Late endosome |
IDA |
17461796, 18039658 |
GO:0005783 |
Component |
Endoplasmic reticulum |
IDA |
17461796 |
GO:0005788 |
Component |
Endoplasmic reticulum lumen |
TAS |
|
GO:0005791 |
Component |
Rough endoplasmic reticulum |
IEA |
|
GO:0005794 |
Component |
Golgi apparatus |
IDA |
17461796 |
GO:0005886 |
Component |
Plasma membrane |
IDA |
18799458 |
GO:0006641 |
Process |
Triglyceride metabolic process |
IEA |
|
GO:0006644 |
Process |
Phospholipid metabolic process |
IEA |
|
GO:0006915 |
Process |
Apoptotic process |
IEA |
|
GO:0007041 |
Process |
Lysosomal transport |
IDA |
17452316 |
GO:0008203 |
Process |
Cholesterol metabolic process |
IEA |
|
GO:0009267 |
Process |
Cellular response to starvation |
ISS |
16407292 |
GO:0009986 |
Component |
Cell surface |
IDA |
17461796 |
GO:0010469 |
Process |
Regulation of signaling receptor activity |
IDA |
17328821 |
GO:0010989 |
Process |
Negative regulation of low-density lipoprotein particle clearance |
IDA |
17328821, 22848640 |
GO:0016540 |
Process |
Protein autoprocessing |
IDA |
14622975 |
GO:0019871 |
Function |
Sodium channel inhibitor activity |
IDA |
22493497 |
GO:0022008 |
Process |
Neurogenesis |
ISS |
12552133 |
GO:0030134 |
Component |
COPII-coated ER to Golgi transport vesicle |
IEA |
|
GO:0030169 |
Function |
Low-density lipoprotein particle binding |
ISS |
|
GO:0030182 |
Process |
Neuron differentiation |
ISS |
12552133 |
GO:0030547 |
Function |
Receptor inhibitor activity |
IDA |
22848640 |
GO:0031232 |
Component |
Extrinsic component of external side of plasma membrane |
IC |
17328821 |
GO:0032802 |
Process |
Low-density lipoprotein particle receptor catabolic process |
IDA |
16912035, 18197702 |
GO:0032802 |
Process |
Low-density lipoprotein particle receptor catabolic process |
TAS |
|
GO:0032805 |
Process |
Positive regulation of low-density lipoprotein particle receptor catabolic process |
IDA |
22848640 |
GO:0032869 |
Process |
Cellular response to insulin stimulus |
ISS |
12552133 |
GO:0034185 |
Function |
Apolipoprotein binding |
ISS |
|
GO:0034189 |
Function |
Very-low-density lipoprotein particle binding |
ISS |
|
GO:0034190 |
Function |
Apolipoprotein receptor binding |
IDA |
18039658 |
GO:0034383 |
Process |
Low-density lipoprotein particle clearance |
TAS |
|
GO:0036020 |
Component |
Endolysosome membrane |
TAS |
|
GO:0042157 |
Process |
Lipoprotein metabolic process |
IEA |
|
GO:0042632 |
Process |
Cholesterol homeostasis |
IMP |
17170371 |
GO:0043523 |
Process |
Regulation of neuron apoptotic process |
ISS |
|
GO:0043525 |
Process |
Positive regulation of neuron apoptotic process |
IMP |
17051583 |
GO:0043621 |
Function |
Protein self-association |
IDA |
18197702 |
GO:0043687 |
Process |
Post-translational protein modification |
TAS |
|
GO:0044267 |
Process |
Cellular protein metabolic process |
TAS |
|
GO:0048471 |
Component |
Perinuclear region of cytoplasm |
IDA |
18039658 |
GO:0050750 |
Function |
Low-density lipoprotein particle receptor binding |
IDA |
17080197 |
GO:0050750 |
Function |
Low-density lipoprotein particle receptor binding |
IPI |
17452316, 22848640 |
GO:0070326 |
Function |
Very-low-density lipoprotein particle receptor binding |
IDA |
18039658 |
GO:1905596 |
Process |
Negative regulation of low-density lipoprotein particle receptor binding |
IDA |
22848640 |
GO:1905598 |
Process |
Negative regulation of low-density lipoprotein receptor activity |
IDA |
22848640 |
GO:1905601 |
Process |
Negative regulation of receptor-mediated endocytosis involved in cholesterol transport |
IDA |
22848640 |
GO:1990666 |
Component |
PCSK9-LDLR complex |
IDA |
22848640 |
GO:1990667 |
Component |
PCSK9-AnxA2 complex |
IDA |
22848640 |
GO:2000272 |
Process |
Negative regulation of signaling receptor activity |
IEA |
|
GO:2000650 |
Process |
Negative regulation of sodium ion transmembrane transporter activity |
IDA |
22493497 |
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
Q8NBP7 |
Protein name |
Proprotein convertase subtilisin/kexin type 9 (EC 3.4.21.-) (Neural apoptosis-regulated convertase 1) (NARC-1) (Proprotein convertase 9) (PC9) (Subtilisin/kexin-like protease PC9) |
Protein function |
Crucial player in the regulation of plasma cholesterol homeostasis. Binds to low-density lipid receptor family members: low density lipoprotein receptor (LDLR), very low density lipoprotein receptor (VLDLR), apolipoprotein E receptor (LRP1/APOER |
PDB |
2P4E
,
2PMW
,
2QTW
,
2W2M
,
2W2N
,
2W2O
,
2W2P
,
2W2Q
,
2XTJ
,
3BPS
,
3GCW
,
3GCX
,
3H42
,
3M0C
,
3P5B
,
3P5C
,
3SQO
,
4K8R
,
4NE9
,
4NMX
,
4OV6
,
5OCA
,
5VL7
,
5VLA
,
5VLH
,
5VLK
,
5VLL
,
5VLP
,
6E4Y
,
6E4Z
,
6MV5
,
6OLZ
,
6OM0
,
6OM7
,
6U26
,
6U2F
,
6U2N
,
6U2P
,
6U36
,
6U38
,
6U3I
,
6U3X
,
7ANQ
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF05922 |
Inhibitor_I9 |
77 → 152 |
Peptidase inhibitor I9 |
Domain |
PF00082 |
Peptidase_S8 |
177 → 436 |
Subtilase family |
Domain |
PF18459 |
PCSK9_C1 |
449 → 531 |
Proprotein convertase subtilisin-like/kexin type 9 C-terminal domain |
Domain |
PF18464 |
PCSK9_C2 |
535 → 600 |
Proprotein convertase subtilisin-like/kexin type 9 C-terminal domain |
Domain |
PF18463 |
PCSK9_C3 |
602 → 682 |
Proprotein convertase subtilisin-like/kexin type 9 C-terminal domain |
Domain |
|
Sequence |
|
Sequence length |
692 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Coronary artery disease |
Coronary Artery Disease |
rs137852988, rs121918313, rs121918529, rs121918531, rs137852340, rs405509, rs1555800701, rs1215189537 |
28714975, 21378990, 29212778, 27135400, 30104761 |
Hypercholesterolemia |
Hypercholesterolemia, Hypercholesterolemia, Familial, Familial hypercholesterolemia - homozygous, HYPERCHOLESTEROLEMIA, AUTOSOMAL DOMINANT, 3, NON RARE IN EUROPE: Heterozygous familial hypercholesterolemia |
rs28942111, rs28942112, rs137852912, rs121908025, rs28942082, rs28942083, rs121908028, rs121908030, rs28942079, rs28942084, rs121908032, rs387906302, rs387906303, rs121908033, rs121908034, rs387906304, rs387906305, rs121908036, rs387906306, rs121908037, rs200238879, rs121908040, rs267607213, rs121908041, rs121908042, rs145787161, rs121908043, rs121908044, rs121908324, rs1557703339, rs121908325, rs1553170279, rs755104973, rs1461905374, rs781585299, rs751141, rs121918386, rs587776886, rs193922566, rs137943601, rs193922567, rs193922569, rs193922571, rs144467873, rs137853966, rs137853965, rs377271627, rs144172724, rs139043155, rs368657165, rs146200173, rs368562025, rs139624145, rs370777955, rs373646964, rs137929307, rs374045590, rs139617694, rs730880131, rs730880130, rs730882080, rs200727689, rs557344672, rs730882085, rs730882086, rs730882090, rs544453230, rs730882098, rs570942190, rs193922568, rs730882102, rs730882109, rs201102492, rs730882110, rs793888522, rs793888517, rs146651743, rs794728683, rs794728585, rs376459828, rs768563000, rs794728584, rs375009082, rs869025453, rs869025454, rs758194385, rs769446356, rs869320649, rs869320652, rs875989888, rs551747280, rs544203837, rs875989889, rs875989890, rs875989891, rs875989893, rs875989894, rs771019366, rs563390335, rs875989895, rs875989896, rs875989897, rs875989898, rs769383881, rs875989900, rs537484504, rs875989901, rs199774121, rs875989902, rs875989903, rs121908027, rs875989905, rs875989906, rs577934998, rs121908029, rs875989907, rs875989908, rs875989909, rs11547917, rs875989911, rs875989910, rs875989912, rs761954844, rs875989914, rs767767730, rs875989915, rs875989916, rs875989917, rs765696008, rs552422789, rs28942078, rs875989919, rs875989920, rs875989921, rs875989922, rs875989925, rs875989926, rs875989927, rs875989928, rs875989929, rs875989930, rs875989932, rs370245937, rs875989934, rs875989935, rs875989936, rs875989937, rs775092314, rs875989938, rs875989941, rs875989943, rs750518671, rs28942085, rs876657697, rs756039188, rs878854026, rs878854028, rs878854027, rs879254363, rs879254368, rs879254374, rs879254382, rs879254383, rs879254384, rs201016593, rs879254386, rs879254385, rs879254387, rs879254388, rs879254390, rs879254393, rs879254394, rs879254395, rs879254396, rs879254397, rs879254398, rs879254399, rs879254400, rs2228671, rs879254401, rs776421777, rs879254402, rs879254403, rs879254404, rs879254405, rs879254406, rs879254407, rs879254408, rs879254409, rs879254410, rs879254411, rs879254412, rs879254413, rs879254414, rs879254415, rs754676104, rs387906301, rs879254417, rs879254418, rs879254419, rs879254423, rs879254422, rs879254424, rs879254425, rs879254426, rs879254428, rs879254430, rs879254432, rs879254433, rs879254434, rs1555802710, rs879254435, rs879254436, rs879254437, rs879254438, rs879254439, rs758927662, rs879254440, rs879254442, rs879254443, rs879254445, rs879254447, rs879254446, rs879254448, rs879254452, rs199570811, rs879254453, rs879254455, rs777640882, rs749038326, rs372828849, rs745776977, rs879254456, rs879254457, rs139400379, rs372845091, rs879254458, rs879254459, rs879254460, rs879254461, rs764797225, rs879254464, rs879254463, rs879254465, rs112029328, rs879254466, rs879254467, rs879254470, rs879254471, rs879254472, rs879254475, rs879254476, rs879254477, rs879254478, rs879254479, rs879254480, rs879254481, rs774723292, rs879254482, rs879254485, rs879254483, rs879254484, rs879254487, rs879254488, rs879254489, rs879254490, rs879254491, rs879254492, rs879254493, rs879254494, rs879254496, rs879254497, rs879254499, rs875989899, rs879254500, rs879254501, rs879254502, rs879254503, rs879254505, rs879254504, rs879254506, rs879254507, rs879254509, rs879254510, rs879254512, rs879254514, rs879254515, rs879254516, rs755799528, rs879254517, rs879254518, rs748944640, rs879254519, rs879254520, rs879254521, rs879254522, rs879254523, rs879254524, rs879254525, rs879254526, rs879254528, rs879254530, rs879254531, rs879254532, rs879254533, rs879254534, rs879254535, rs879254536, rs766094434, rs879254537, rs879254538, rs763998635, rs879254540, rs879254542, rs879254543, rs879254545, rs879254546, rs879254547, rs879254548, rs752596535, rs879254549, rs879254550, rs879254551, rs879254552, rs879254554, rs879254555, rs879254557, rs879254556, rs879254558, rs879254560, rs879254559, rs769318035, rs879254561, rs879254562, rs879254563, rs879254565, rs879254564, rs879254566, rs879254567, rs879254568, rs879254569, rs879254570, rs879254572, rs879254571, rs879254573, rs879254574, rs879254575, rs879254577, rs879254579, rs879254580, rs879254581, rs879254582, rs879254584, rs748672083, rs879254588, rs879254591, rs879254592, rs879254593, rs879254594, rs879254595, rs879254596, rs879254597, rs879254598, rs879254599, rs879254600, rs771917370, rs879254602, rs879254605, rs879254606, rs764042910, rs879254607, rs879254608, rs879254610, rs879254609, rs879254611, rs879254612, rs879254613, rs879254614, rs879254615, rs879254616, rs879254358, rs1555803428, rs879254619, rs373822756, rs879254620, rs879254622, rs756613387, rs879254623, rs879254624, rs1555803424, rs879254627, rs879254625, rs879254626, rs879254628, rs879254629, rs879254630, rs1555803414, rs879254631, rs1555803423, rs1555803426, rs879254632, rs879254633, rs879254635, rs879254634, rs879254636, rs879254638, rs1555803427, rs879254639, rs879254640, rs879254641, rs879254642, rs746091400, rs879254644, rs121908035, rs879254645, rs879254646, rs879254647, rs879254651, rs879254652, rs1555803643, rs1555803644, rs879254653, rs879254655, rs879254656, rs879254658, rs879254659, rs879254660, rs879254662, rs879254663, rs879254664, rs879254666, rs759109699, rs879254667, rs879254668, rs879254669, rs879254670, rs879254671, rs879254672, rs879254673, rs879254674, rs879254675, rs879254677, rs879254678, rs879254681, rs879254682, rs879254683, rs773328511, rs879254684, rs879254685, rs879254686, rs879254688, rs879254689, rs879254691, rs879254692, rs730882089, rs879254693, rs140241383, rs375495026, rs879254697, rs879254696, rs879254699, rs879254700, rs879254701, rs879254702, rs879254703, rs879254704, rs879254705, rs879254706, rs879254708, rs879254710, rs879254712, rs767618089, rs879254713, rs879254714, rs879254716, rs879254717, rs757252110, rs879254718, rs879254719, rs879254720, rs879254721, rs879254723, rs879254725, rs879254727, rs879254728, rs13306512, rs879254729, rs879254734, rs112366278, rs879254735, rs879254736, rs746834464, rs879254737, rs879254738, rs879254739, rs879254740, rs879254743, rs879254744, rs879254745, rs879254746, rs879254747, rs879254748, rs879254749, rs767024374, rs879254751, rs879254752, rs879254753, rs879254754, rs879254755, rs879254757, rs755757866, rs879254758, rs777524402, rs730882096, rs879254760, rs879254761, rs879254762, rs879254763, rs879254764, rs748300548, rs879254765, rs879254767, rs879254768, rs879254769, rs13306515, rs879254770, rs879254771, rs879254773, rs879254774, rs755449669, rs879254775, rs879254777, rs879254778, rs879254781, rs879254780, rs879254782, rs879254783, rs879254784, rs879254786, rs879254788, rs879254789, rs746982741, rs879254791, rs768430352, rs113669610, rs879254792, rs879254794, rs879254796, rs879254797, rs879254799, rs1555804777, rs879254800, rs773064328, rs879254801, rs879254802, rs1555804793, rs879254804, rs879254805, rs879254807, rs879254806, rs879254811, rs879254812, rs879254814, rs879254813, rs879254815, rs879254816, rs879254817, rs879254820, rs879254819, rs879254821, rs879254823, rs879254824, rs879254826, rs879254827, rs879254828, rs879254829, rs879254830, rs879254832, rs879254833, rs879254835, rs879254837, rs879254838, rs879254839, rs879254840, rs879254841, rs879254842, rs879254844, rs879254846, rs773658037, rs869320651, rs774439908, rs879254848, rs879254849, rs879254850, rs879254851, rs879254854, rs879254855, rs879254856, rs745343524, rs879254857, rs879254858, rs779732323, rs879254859, rs879254862, rs879254863, rs879254864, rs879254865, rs879254866, rs879254867, rs879254868, rs879254869, rs879254872, rs879254873, rs879254874, rs775924858, rs879254875, rs531005522, rs879254879, rs879254880, rs879254881, rs879254882, rs879254883, rs879254884, rs879254885, rs879254886, rs879254887, rs879254888, rs879254892, rs879254893, rs201967266, rs879254896, rs879254898, rs879254899, rs879254901, rs879254902, rs879254904, rs879254907, rs879254906, rs879254913, rs879254915, rs879254916, rs879254918, rs879254919, rs751603969, rs879254921, rs879254922, rs879254923, rs755667663, rs879254924, rs730882103, rs879254927, rs879254929, rs879254930, rs879254931, rs879254932, rs879254933, rs879254935, rs879254939, rs879254941, rs755389753, rs879254945, rs879254947, rs879254948, rs879254949, rs879254950, rs879254951, rs746939188, rs879254952, rs879254955, rs879254956, rs879254957, rs879254958, rs879254959, rs769370816, rs879254962, rs879254963, rs879254964, rs879254965, rs759876319, rs879254966, rs28942081, rs879254967, rs879254970, rs879254969, rs879254971, rs28941776, rs879254973, rs879254972, rs879254975, rs879254976, rs879254977, rs879254978, rs879254979, rs879254980, rs879254981, rs879254982, rs879254985, rs879254984, rs879254986, rs879254988, rs879254989, rs746959386, rs879254990, rs879254991, rs879254994, rs879254996, rs879254998, rs879254999, rs879255000, rs138947766, rs879255001, rs879255003, rs879255004, rs879255005, rs879255006, rs879255007, rs879255009, rs879255008, rs879255011, rs879255012, rs879255013, rs879255014, rs879255015, rs879255016, rs875989931, rs879255019, rs879255020, rs879255021, rs879255022, rs879255026, rs753707206, rs879255027, rs879255028, rs879255029, rs879255031, rs879255032, rs879255033, rs879255034, rs879255035, rs879255038, rs879255037, rs879255039, rs879255041, rs879255044, rs879255046, rs879255049, rs879255050, rs879255051, rs879255052, rs747134711, rs879255053, rs879255054, rs879255055, rs875989933, rs879255057, rs879255058, rs879255059, rs879255060, rs879255061, rs879255063, rs879255065, rs879255066, rs879255069, rs879255068, rs879255070, rs754536745, rs879255073, rs879255076, rs879255077, rs879255078, rs879255079, rs879255082, rs1555807275, rs879255088, rs879255089, rs879255090, rs879255092, rs773693079, rs879255093, rs879255096, rs879255097, rs879255098, rs1555807306, rs879255101, rs879255102, rs879255104, rs752935814, rs879255106, rs150021927, rs879255107, rs879255109, rs879255108, rs879255110, rs879255112, rs770744861, rs745753810, rs879255113, rs879255114, rs879255115, rs879255116, rs879255117, rs760436036, rs879255118, rs201637900, rs121908031, rs879255120, rs879255121, rs2569548, rs879255122, rs879255123, rs879255124, rs879255126, rs879255125, rs879255127, rs751228587, rs879255128, rs879255130, rs369943481, rs879255131, rs879255132, rs879255133, rs879255134, rs112954220, rs776217028, rs879255135, rs879255136, rs879255138, rs879255139, rs879255140, rs879255141, rs879255142, rs879255144, rs879255145, rs879255146, rs879255147, rs879255153, rs879255155, rs879255156, rs879255157, rs879255158, rs879255159, rs879255160, rs879255161, rs879255163, rs879255164, rs370018159, rs879255166, rs879255167, rs879255168, rs879255169, rs879255172, rs879255174, rs763625913, rs879255175, rs879255176, rs879255177, rs879255178, rs879255181, rs879255185, rs879255186, rs879255188, rs879255187, rs767790696, rs879255193, rs879255194, rs879255196, rs879255197, rs879255198, rs879255200, rs879255202, rs879255204, rs773618064, rs879255207, rs879255209, rs879255210, rs879255212, rs879255213, rs879255215, rs879255217, rs747344293, rs879255218, rs879255219, rs879255222, rs377437226, rs879255224, rs879255227, rs879255229, rs1555803632, rs886039829, rs886039830, rs886039831, rs1057515537, rs774615547, rs1057516129, rs1057516132, rs1057516133, rs1057516135, rs777326720, rs751122998, rs1057516130, rs774069731, rs879254847, rs1057516134, rs867272973, rs1057516127, rs763147599, rs1057519647, rs1057519648, rs1057519649, rs1057519650, rs751317621, rs774016801, rs1057519652, rs1057519653, rs1057519654, rs1555803257, rs1057519655, rs879254601, rs1057519657, rs1057519662, rs879254618, rs1057519659, rs1057519660, rs1057519661, rs1057519663, rs1057519664, rs1057519665, rs1057519666, rs373869746, rs879254803, rs1057519668, rs1057519669, rs1057519670, rs1057519671, rs1057519672, rs1057519673, rs1057519674, rs879254993, rs1057519676, rs1057519679, rs1057519682, rs1057519683, rs1057519685, rs1057519687, rs1057519690, rs1060499931, rs1060499919, rs1064792905, rs1060499921, rs1060499922, rs1555805127, rs1060499923, rs1060499924, rs1060499926, rs1060499927, rs1555808044, rs1555808111, rs1060499930, rs770696696, rs1060500988, rs1060500987, rs879254637, rs1064794259, rs1555800611, rs1131692189, rs1555802312, rs1131692191, rs1131692192, rs1555803259, rs1131692193, rs1131692194, rs121908039, rs1131692195, rs1131692197, rs1131692198, rs148698650, rs1131692201, rs1131692202, rs879254715, rs370471092, rs1131692203, rs1131692204, rs1131692205, rs1131692206, rs1131692207, rs1131692208, rs1131692209, rs1131692210, rs1131692211, rs1131692214, rs1131692215, rs1131692217, rs1555806546, rs1131692219, rs879255095, rs1131692220, rs1131692221, rs200793488, rs1131692223, rs1131692224, rs1131692225, rs1131692226, rs1135402767, rs1555805507, rs1553137543, rs1382988295, rs1555802270, rs934496989, rs1555806455, rs1555807335, rs1555803481, rs1555804717, rs1372204035, rs1553135930, rs1057519691, rs1254346075, rs1553137693, rs1553137699, rs886046435, rs1553382295, rs1553382319, rs1553382325, rs1442815965, rs747606537, rs5742904, rs1553385404, rs1553385715, rs1555800620, rs1555800631, rs1555800632, rs1555800648, rs1555800724, rs1555802242, rs1555802245, rs1555802258, rs1555802287, rs200660051, rs1398808477, rs1555802822, rs752191968, rs1555803191, rs1555803213, rs879254529, rs754933794, rs1555803327, rs1555803337, rs1555803354, rs1013147010, rs1555803383, rs1555803391, rs753319170, rs1555803409, rs1555803432, rs1555803449, rs1555803641, rs1555803701, rs1555803837, rs1555803841, rs1555803879, rs1555803891, rs1555804443, rs1555804700, rs730882099, rs1225797407, rs879254871, rs1555805337, rs1555805348, rs1555805360, rs1555805380, rs1555805490, rs1555805530, rs1555805531, rs1555805985, rs1555806110, rs1555806448, rs1555806467, rs1555806582, rs778408161, rs1555807261, rs1555807390, rs1555807388, rs1555807421, rs1555807465, rs1555807475, rs1555808008, rs1555808107, rs1555808114, rs1555808118, rs1555808120, rs1555808139, rs875989942, rs1555809471, rs1555809490, rs1555809520, rs1555800701, rs762417023, rs1555802259, rs1555802291, rs1555803186, rs1555803254, rs1555803280, rs879254541, rs1555803455, rs1555803439, rs1555803471, rs1555803912, rs1555804467, rs1555804545, rs1555805947, rs879254992, rs1555807356, rs1555808143, rs1555805930, rs1201229554, rs1555806529, rs779921498, rs1555807206, rs753151497, rs1208216597, rs1555803908, rs1323416354, rs1555805409, rs1555805413, rs774467219, rs1555806088, rs1568600415, rs777903106, rs1568606711, rs1568610747, rs1568600459, rs1568592055, rs1568582652, rs1568591929, rs1568594903, rs1568600328, rs1600743301, rs750383461, rs1600683731, rs1600704961, rs1600715039, rs1600720921, rs1555804729, rs1600727337, rs1600727715, rs1600732894, rs1600726930, rs1600742966, rs1600762098, rs1600765031, rs1600715089, rs879255149, rs1600715567, rs1600732566, rs1257344396, rs1572802096, rs763778803, rs2044384127, rs2077272442, rs2077276411, rs2077276612, rs2077282480, rs2077297994, rs879254707, rs2077361078, rs2077408020, rs2077409930, rs2077412367, rs2077417709, rs2077419273, rs2077459772, rs2077475503, rs2077534881, rs762148512, rs140807148, rs2077460968, rs2077315885, rs2077271255 |
12730697, 23433573, 27998977, 26374825, 23433573, 22683120, 24115837, 26036859, 24859021, 26374825, 25962062, 21146822, 20006333, 17316651, 25014035, 28777095, 27206942, 18631360, 16183066, 23433573, 23680767, 26374825, 20006333, 12730697, 22683120, 19081568, 27896130, 16909389, 24607922, 23375686, 18799458, 17765244, 18266662, 27280970, 24808179 |
Hyperlipidemia |
Hyperlipidemia |
rs118204057, rs118204060, rs118204062, rs1563569634, rs118204069, rs118204070, rs118204071, rs3737787, rs2073658, rs1566946168, rs1064797075 |
|
Hyperlipoproteinemia |
Hyperlipoproteinemia Type IIa |
rs118204056, rs118204057, rs118204058, rs118204059, rs1563572716, rs118204060, rs118204067, rs118204062, rs118204074, rs118204063, rs118204064, rs1563569634, rs118204065, rs118204066, rs1563575252, rs118204068, rs118204069, rs118204070, rs766134215, rs118204071, rs118204072, rs118204073, rs118204075, rs118204076, rs118204077, rs118204078, rs118204079, rs118204080, rs118204081, rs118204082, rs121917821, rs121918393, rs397514253, rs397514254, rs121918394, rs2122132718, rs121918396, rs121918397, rs387906567, rs587777637, rs587777638, rs587777639, rs587777640, rs587777641, rs587777642, rs587777643, rs886037774, rs201079485, rs1554517725, rs371282890, rs35414700 |
|
Hypertension |
Hypertensive disease |
rs13306026, rs13333226 |
|
Hypobetalipoproteinemia |
NON RARE IN EUROPE: Familial hypobetalipoproteinemia |
rs281865425, rs397514255, rs121918383, rs121918384, rs121918385, rs121918386, rs387906569, rs397514256, rs121918387, rs121918389, rs121918390, rs587776852, rs1572800245, rs606231236, rs797045253, rs143301836, rs1057518647, rs1553382678, rs756209187, rs759934326, rs1553383898, rs1553384177, rs1553384441, rs1553385404 |
|
Myocardial infarction |
Myocardial Infarction |
rs12316150, rs41303970, rs909253, rs7291467, rs2234693 |
|
Nephroblastoma |
Nephroblastoma |
rs1553551874, rs1555913934, rs769116796 |
22544364 |
Supravalvar aortic stenosis |
Supravalvular aortic stenosis |
rs137854452, rs137854453, rs2132322943, rs1563826213, rs137854454, rs137854455, rs1554686162, rs397516433, rs727503783, rs727503782, rs727503022, rs727503023, rs727503024, rs727503026, rs727503027, rs727503028, rs727503029, rs727503031, rs727503033, rs727503034, rs727503035, rs727504419, rs727504433, rs727504434, rs727504581, rs730880355, rs863223518, rs863223520, rs200862792, rs878854452, rs886039351, rs1554669800, rs1554672602, rs1554672587, rs1554666513, rs1554669297, rs1554676454, rs1400530335, rs1563836689, rs1563793627, rs1583959262, rs1584494326, rs1583818183, rs1787875866, rs1791626037, rs1794096639, rs1794104889, rs199621188, rs1795205877, rs1797063858, rs782528759, rs1797218441, rs782674700 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Arteriosclerosis |
Premature arteriosclerosis |
|
|
Cardiovascular diseases |
Cardiovascular Diseases |
|
30595370 |
Cerebral artery atherosclerosis |
Cerebral artery atherosclerosis |
|
|
Coronary aneurysm |
Coronary Aneurysm |
|
|
Coronary arteriosclerosis |
Coronary Arteriosclerosis |
|
27135400, 21378990 |
Coronary heart disease |
Coronary heart disease |
rs9289231, rs281864746 |
21347282 |
Fatty liver |
Fatty Liver, Steatohepatitis |
|
|
Homozygous hypercholesterolemia |
Homozygous familial hypercholesterolemia |
|
|
Hypocholesterolemia |
Hypocholesterolemia |
|
|
Peripheral arterial stenosis |
Peripheral arterial stenosis |
|
|
Renal artery stenosis |
Renal Artery Stenosis |
|
|
Renal steatosis |
Renal steatosis |
|
|
Xanthoma tendinosum |
Xanthoma tendinosum |
|
|
|
|
|