ALPL (alkaline phosphatase, biomineralization associated)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
249 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Alkaline phosphatase, biomineralization associated |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
ALPL |
SynonymsGene synonyms aliases
|
AP-TNAP, APTNAP, HOPS, HPPA, HPPC, HPPI, HPPO, TNALP, TNAP, TNS-ALP, TNSALP |
ChromosomeChromosome number
|
1 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
1p36.12 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene encodes a member of the alkaline phosphatase family of proteins. There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The first three are located |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs121918000 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs121918001 |
C>A,T |
Likely-pathogenic |
Missense variant, intron variant, coding sequence variant |
rs121918002 |
A>C |
Pathogenic |
Missense variant, coding sequence variant |
rs121918003 |
G>A,C |
Pathogenic |
Missense variant, intron variant, coding sequence variant |
rs121918004 |
A>C |
Pathogenic |
Missense variant, coding sequence variant |
rs121918005 |
C>G,T |
Pathogenic |
Missense variant, coding sequence variant, 5 prime UTR variant, upstream transcript variant, genic upstream transcript variant |
rs121918006 |
T>C |
Pathogenic |
Missense variant, coding sequence variant |
rs121918007 |
G>A,C |
Pathogenic-likely-pathogenic, pathogenic |
Missense variant, coding sequence variant |
rs121918008 |
A>T |
Pathogenic |
Missense variant, coding sequence variant |
rs121918009 |
G>A |
Likely-pathogenic, pathogenic |
Missense variant, coding sequence variant |
rs121918010 |
T>C |
Pathogenic-likely-pathogenic, pathogenic, likely-pathogenic |
Missense variant, coding sequence variant |
rs121918011 |
G>A,C |
Pathogenic, uncertain-significance |
Missense variant, coding sequence variant |
rs121918012 |
G>T |
Pathogenic, uncertain-significance |
Missense variant, coding sequence variant |
rs121918013 |
G>A |
Likely-pathogenic, pathogenic |
Missense variant, coding sequence variant |
rs121918014 |
A>G |
Likely-pathogenic, pathogenic |
Missense variant, coding sequence variant |
rs121918015 |
C>T |
Pathogenic |
Missense variant, coding sequence variant |
rs121918016 |
G>A |
Pathogenic |
Missense variant, coding sequence variant |
rs121918017 |
G>A,C |
Pathogenic |
Missense variant, coding sequence variant |
rs121918018 |
G>C,T |
Pathogenic-likely-pathogenic, pathogenic, uncertain-significance |
Missense variant, coding sequence variant |
rs121918019 |
G>A,C |
Likely-pathogenic, pathogenic |
Missense variant, coding sequence variant |
rs121918020 |
C>T |
Pathogenic |
Missense variant, coding sequence variant |
rs139811782 |
G>A |
Likely-pathogenic |
Missense variant, intron variant, coding sequence variant |
rs141448778 |
C>T |
Conflicting-interpretations-of-pathogenicity |
Coding sequence variant, synonymous variant |
rs148405563 |
C>G,T |
Conflicting-interpretations-of-pathogenicity, likely-benign |
Missense variant, coding sequence variant |
rs149889416 |
G>A |
Likely-pathogenic, pathogenic |
Missense variant, coding sequence variant |
rs199590449 |
C>T |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs199665722 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs199669988 |
G>A |
Pathogenic, uncertain-significance |
Missense variant, coding sequence variant |
rs370122334 |
C>A,T |
Uncertain-significance, conflicting-interpretations-of-pathogenicity |
Coding sequence variant, synonymous variant |
rs371243939 |
C>T |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs376221105 |
C>A,G,T |
Pathogenic |
Coding sequence variant, missense variant, stop gained |
rs387906525 |
T>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs749544042 |
G>A |
Pathogenic |
Splice donor variant |
rs750174638 |
C>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
rs751404811 |
C>-,CC |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
rs751994699 |
GG>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs753338851 |
CTT>- |
Pathogenic, likely-pathogenic |
Coding sequence variant, inframe deletion |
rs754826836 |
->T |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
rs755529290 |
C>A,T |
Likely-pathogenic |
Synonymous variant, coding sequence variant, stop gained |
rs760134827 |
C>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
rs763159520 |
C>T |
Likely-pathogenic, uncertain-significance |
Coding sequence variant, missense variant |
rs763244290 |
T>- |
Likely-pathogenic |
Frameshift variant, 5 prime UTR variant, coding sequence variant |
rs764322898 |
T>G |
Likely-pathogenic |
Intron variant, splice donor variant, genic upstream transcript variant |
rs764908423 |
->G |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
rs766076920 |
C>T |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs768160006 |
G>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs769948289 |
G>-,GG |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs771540767 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs772638759 |
ACCCCCTGAGCGTCCT>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs773257111 |
G>A |
Pathogenic |
Missense variant, coding sequence variant |
rs781264043 |
T>C |
Likely-pathogenic |
Missense variant, coding sequence variant, intron variant |
rs781272386 |
G>A,C,T |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs786204442 |
A>G |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs786204473 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs786204530 |
AC>CA |
Pathogenic, not-provided, likely-pathogenic |
Missense variant, coding sequence variant |
rs786204634 |
G>A |
Likely-pathogenic |
Coding sequence variant, stop gained |
rs886044912 |
C>T |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1057516230 |
AACT>- |
Likely-pathogenic, pathogenic |
Frameshift variant, intron variant, coding sequence variant, genic upstream transcript variant |
rs1057516293 |
C>T |
Likely-pathogenic |
Stop gained, 5 prime UTR variant, coding sequence variant, synonymous variant |
rs1057516334 |
C>T |
Likely-pathogenic |
5 prime UTR variant, coding sequence variant, genic upstream transcript variant, upstream transcript variant, stop gained |
rs1057516526 |
C>-,CC |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1057516622 |
A>G |
Likely-pathogenic |
Splice acceptor variant |
rs1057516702 |
TC>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1057517173 |
G>T |
Likely-pathogenic |
Stop gained, coding sequence variant |
rs1057517304 |
T>A |
Likely-pathogenic |
Splice donor variant, intron variant |
rs1057517321 |
A>- |
Likely-pathogenic |
Frameshift variant, 5 prime UTR variant, coding sequence variant, genic upstream transcript variant, upstream transcript variant |
rs1057517322 |
->GCAG |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1057517337 |
CCTGCTGCTCGCGCTGGCCC>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1057517391 |
T>A,G |
Pathogenic |
Splice donor variant |
rs1131691372 |
C>T |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs1201942473 |
C>T |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs1344601362 |
CT>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1413274209 |
G>A |
Likely-pathogenic, pathogenic |
Missense variant, coding sequence variant |
rs1553411779 |
G>A |
Likely-pathogenic |
Coding sequence variant, stop gained, genic upstream transcript variant, 5 prime UTR variant, upstream transcript variant |
rs1553411890 |
->G |
Likely-pathogenic |
Splice acceptor variant, coding sequence variant, intron variant |
rs1553411896 |
GCTGCCCG>- |
Likely-pathogenic |
Intron variant, coding sequence variant, frameshift variant |
rs1553411920 |
->TCAG |
Likely-pathogenic |
Intron variant, coding sequence variant, frameshift variant |
rs1553412246 |
C>- |
Likely-pathogenic |
Stop gained, coding sequence variant |
rs1553412310 |
G>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1553413512 |
G>A |
Likely-pathogenic |
Splice donor variant |
rs1553414078 |
AGGGGAC>T |
Likely-pathogenic |
Inframe deletion, coding sequence variant |
rs1553414111 |
G>A |
Conflicting-interpretations-of-pathogenicity |
Coding sequence variant, synonymous variant |
rs1553414133 |
G>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1553414560 |
C>T |
Likely-pathogenic |
Stop gained, coding sequence variant |
rs1553414600 |
CT>- |
Likely-pathogenic, pathogenic |
Coding sequence variant, frameshift variant |
rs1553414843 |
GACA>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1553415035 |
C>T |
Likely-pathogenic |
Stop gained, coding sequence variant |
rs1553415164 |
CT>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1558543066 |
A>- |
Pathogenic |
Intron variant, frameshift variant, coding sequence variant, genic upstream transcript variant |
rs1558548925 |
C>T |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1558557341 |
CTC>- |
Pathogenic |
Inframe deletion, coding sequence variant |
rs1558557428 |
A>G |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1558558939 |
T>G |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1558558976 |
G>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
rs1570276921 |
G>A |
Likely-pathogenic |
Coding sequence variant, missense variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Transcription factors
|
Transcription factor |
Regulation |
Reference |
SP3 |
Activation |
11073119 |
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P05186 |
Protein name |
Alkaline phosphatase, tissue-nonspecific isozyme (AP-TNAP) (TNS-ALP) (TNSALP) (EC 3.1.3.1) (Alkaline phosphatase liver/bone/kidney isozyme) (Phosphoamidase) (Phosphocreatine phosphatase) (EC 3.9.1.1) |
Protein function |
Alkaline phosphatase that metabolizes various phosphate compounds and plays a key role in skeletal mineralization and adaptive thermogenesis (PubMed:12162492, PubMed:23688511, PubMed:25982064). Has broad substrate specificity and can hydrolyze a |
PDB |
7YIV
,
7YIW
,
7YIX
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF00245 |
Alk_phosphatase |
51 → 490 |
Alkaline phosphatase |
Domain |
|
Sequence |
|
Sequence length |
524 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Anemia |
Anemia |
rs118204044, rs118204045, rs118204046, rs121918330, rs869320719, rs869312029, rs121918332, rs869320724, rs767094129, rs786205058, rs786205059, rs137853119, rs137853120, rs137853121, rs1384933966, rs137853122, rs137853123, rs786205060, rs267607121, rs121908584, rs80338697, rs80338699, rs120074166, rs120074167, rs1050828, rs74575103, rs137852314, rs5030868, rs137852316, rs137852317, rs137852318, rs137852319, rs137852320, rs137852321, rs137852322, rs137852323, rs137852324, rs72554665, rs387906468, rs5030872, rs137852326, rs137852333, rs137852327, rs137852328, rs137852329, rs137852330, rs137852331, rs137852332, rs137852334, rs137852335, rs137852336, rs137852339, rs76645461, rs137852340, rs137852341, rs78478128, rs137852343, rs137852344, rs137852345, rs587776730, rs137852346, rs137852347, rs137852349, rs2070404412, rs2070350038, rs2070350009, rs137852303, rs137852304, rs33946267, rs34378160, rs33933298, rs11549407, rs35724775, rs34598529, rs41469945, rs267607201, rs80338694, rs80338696, rs387907018, rs398123546, rs78365220, rs587777100, rs587777101, rs483352840, rs869312752, rs765487627, rs1557229599, rs1557230040, rs1555524842, rs782090947, rs1358275550, rs1557229736, rs1557230573, rs1556323334, rs1233124208, rs1293528130, rs146864395, rs1595503440, rs1603411214, rs137852325, rs1575247302, rs1603411177, rs1336651679, rs782322505 |
|
Chondrocalcinosis |
Calcium pyrophosphate deposition disease |
rs121908405, rs28939080, rs121908407, rs2126640512, rs121908408, rs121908409, rs121908410 |
|
Craniosynostosis |
Craniosynostosis |
rs104893895, rs587777006, rs587777007, rs587777008, rs587777010, rs281865153, rs281865154, rs864321680, rs864321681, rs1057517670, rs1085307122, rs1064794325, rs1884302, rs1555750816, rs1599823350 |
|
Hypercalcemia |
Hypercalcemia |
rs876657376, rs387907322, rs777676129, rs387907323, rs114368325, rs6068812, rs387907324, rs777947329, rs201304511, rs769409705, rs200095793, rs876661338, rs1554095500, rs139763321, rs774432244, rs781367354 |
|
Hyperparathyroidism |
Hyperparathyroidism, Secondary |
rs28942098, rs121434262, rs80356649, rs121434264, rs587776558, rs587776559, rs121909259, rs104893689, rs28936684, rs104893690, rs869320729, rs104893700, rs104893705, rs104893707, rs104893709, rs863223311, rs80356650, rs193922432, rs886041637, rs201633414, rs1057519419, rs766719790, rs1281361203, rs759393722, rs1342435095, rs1200458339, rs755916513, rs1586190048, rs1558280170 |
22373954 |
Hypophosphatasia |
Adult hypophosphatasia, Adult hypophosphatasia (disorder), Childhood hypophosphatasia (disorder), Childhood-onset hypophosphatasia, Hypophosphatasia, Hypophosphatasia, Perinatal Lethal, Infantile hypophosphatasia |
rs121918000, rs121918001, rs121918002, rs121918003, rs121918005, rs121918006, rs121918017, rs121918007, rs121918008, rs121918009, rs121918010, rs387906525, rs121918011, rs121918013, rs749544042, rs121918014, rs121918016, rs121918018, rs121918019, rs121918020, rs781264043, rs786204530, rs199590449, rs766076920, rs786204442, rs786204634, rs786204473, rs755529290, rs1057516230, rs764322898, rs1057516334, rs1057517321, rs763244290, rs1057516293, rs1057517304, rs750174638, rs769948289, rs1057516526, rs768160006, rs1057516702, rs1057517391, rs1057516622, rs1057517322, rs771540767, rs149889416, rs1057517173, rs1057517337, rs199665722, rs1057521085, rs766656419, rs1553415164, rs1320839573, rs751994699, rs781272386, rs751404811, rs1553411896, rs1558543066, rs763159520, rs1558557341, rs1553411779, rs1553411890, rs1553411920, rs916300043, rs1553413512, rs1553414560, rs760134827, rs1553415041, rs1384701659, rs1553412310, rs1553414600, rs1553414611, rs1553414843, rs1553415035, rs1054159992, rs772638759, rs764908423, rs1344601362, rs1413274209, rs1553413155, rs769020799, rs1553414133, rs371243939, rs1442918125, rs768976020, rs1558548925, rs1558557428, rs754826836, rs1558558976, rs753338851, rs1201942473, rs773257111, rs1644755212, rs1292415045 |
11760847, 12815606, 3174660, 10834525, 9781036, 30979546, 11479741, 11438998, 11999978, 8954059, 11834095, 19500388, 9747027, 8406453, 10332035, 11745997, 17213282, 9452105, 17916236, 10690885, 22266140, 1409720, 18455459, 23039266, 25982064, 11855933, 10679946, 10737975, 23688511, 7833929, 10094560, 15135428, 15694177, 12920074, 30979546, 10737975, 20739387, 17213282, 1409720, 17719863, 24569605, 17916236, 19500388, 11760847, 10839996, 18769927, 25731960, 12357339, 10094560, 18821074, 10332035, 10737975, 27179278, 15694177, 12162492, 19500388, 28401263, 1409720, 18925618, 24569605, 22913777, 9452105, 20739387, 24276437, 25023282, 17719863, 15135428, 27466191, 11760847, 30293248, 8954059, 11855933, 15137467, 18455459, 11438998, 26783040, 10737975, 17916236, 8954059, 19232125, 8406453, 3174660, 17409132, 19500388, 26783040, 28401263, 28127875, 15840803, 15694177, 18559907, 17922851, 23926372, 25736332, 18523927, 28436937, 28506345, 10839996, 20383509, 17719863, 26459154, 11855933, 18925618, 24100244, 12815606, 18455459, 17916236, 10737975, 9618260, 15137467, 11999978, 1409720, 25731960, 11745997, 20924064, 12162492, 15660230, 21713987, 23454488, 10834525, 23509830, 15135428, 22397652, 19335222, 24569605, 27179278, 7833929, 10332035, 15794757, 28939177, 17253930, 11438998, 20049532, 9562633, 18386808, 16769381, 23688511, 24145968, 11810413, 11479741, 18769927, 16583935, 26432670, 22014174, 11760847, 21956185, 10679946, 28663156, 9452105, 24276437, 21168482, 17213282, 29236161, 23580367, 30979546, 9781036, 27312557, 10094560, 15300736, 12638946 |
Myopathy |
Myopathy |
rs137854521, rs386834236, rs121908557, rs121909092, rs111033570, rs104894299, rs104894294, rs121909273, rs121909274, rs121909275, rs199474699, rs199476140, rs118192165, rs118192169, rs118192166, rs193922856, rs281865489, rs397514675, rs397514676, rs397514677, rs367543058, rs118192117, rs193922837, rs118192129, rs118192143, rs118192153, rs118192133, rs118192156, rs118192149, rs118192148, rs118192183, rs118192147, rs118192123, rs118192127, rs118192142, rs118192144, rs118192178, rs118192151, rs118192150, rs118192184, rs118192154, rs118192134, rs118192155, rs193922893, rs118192132, rs118192146, rs193922867, rs193922884, rs587777528, rs527236030, rs587777672, rs587777673, rs587777674, rs587777675, rs587783343, rs2754158, rs786204796, rs748277951, rs797046047, rs797046064, rs797046060, rs797045479, rs797045931, rs797045932, rs797045934, rs797045935, rs797045477, rs797045478, rs1057518851, rs1057518855, rs1057518773, rs1057518866, rs1555322610, rs1555806119, rs761483896, rs144071404, rs1198364572, rs1568614042, rs978984063, rs1568604308, rs1332371891, rs1601842249, rs777176261, rs1249621033, rs1278804520, rs1568613962, rs1568510406, rs1597512576, rs193922887, rs371455345, rs1603452200, rs1599634685, rs1575065895, rs1575201712, rs139715157, rs1974129338 |
|
Odontohypophosphatasia |
ODONTOHYPOPHOSPHATASIA (disorder), Odontohypophosphatasia |
rs121918007, rs121918011, rs121918013, rs121918015, rs121918018, rs763159520 |
10737975, 17916236 |
Seizure |
Complex partial seizures, Generalized seizures, Visual seizure, Tonic - clonic seizures, Single Seizure |
rs587784365, rs28939683, rs74315390, rs28939684, rs74315391, rs267607198, rs74315392, rs118192244, rs118192250, rs121917749, rs121917750, rs121917751, rs121917752, rs267606670, rs267607061, rs121912707, rs118192249, rs118192251, rs118192217, rs118192218, rs118192219, rs118192222, rs118192226, rs118192228, rs118192234, rs118192236, rs118192235, rs118192241, rs118192242, rs118192185, rs118192188, rs118192245, rs118192246, rs118192186, rs118192194, rs118192197, rs118192199, rs118192201, rs118192202, rs118192203, rs118192204, rs118192205, rs118192206, rs118192208, rs118192211, rs118192216, rs118192239, rs387906684, rs387906686, rs387906687, rs1596893185, rs387907126, rs387907281, rs397515405, rs587778771, rs730882067, rs730882073, rs397514579, rs397514582, rs587776976, rs398122394, rs121918784, rs121918751, rs121918735, rs398123588, rs587780450, rs61749751, rs587777620, rs727503974, rs730882124, rs794726710, rs794726697, rs794726799, rs794727444, rs794727740, rs796053166, rs794726825, rs796052676, rs796053219, rs796053220, rs796053228, rs796052653, rs759584387, rs796052650, rs796052641, rs796052626, rs796052623, rs796052663, rs796052615, rs796052802, rs797044999, rs797045047, rs797045942, rs797045941, rs118192212, rs797044938, rs777257591, rs864321712, rs879255652, rs886039268, rs886039517, rs886039529, rs199497486, rs886039496, rs886039903, rs886041300, rs769827124, rs886041339, rs886041591, rs587783092, rs1555850151, rs1057516123, rs1057516121, rs1057516115, rs1057516111, rs1057516106, rs1057516105, rs756921902, rs1057516089, rs1057516087, rs1057516080, rs1057516076, rs1060499544, rs1555850512, rs1057517919, rs118192231, rs1057520413, rs1060503101, rs1064796294, rs1064794981, rs1064794632, rs1064797245, rs1131691830, rs1131692231, rs1131691936, rs1554626549, rs1553579225, rs1553531385, rs121918736, rs1554898088, rs1553579282, rs763353895, rs1553463119, rs1554093891, rs77838305, rs1555408401, rs1554627439, rs1554097873, rs1555850403, rs1064794719, rs1315483224, rs1567134495, rs770187706, rs1057518555, rs1576983339, rs1574192005, rs1459374430, rs1586800133, rs1574641522, rs1572096837, rs1572630269, rs1574554892, rs1574556643, rs1574571769, rs1574641605, rs1574697769, rs1574716524, rs1574746733, rs1574746935, rs1574752700, rs1574754680, rs863225030, rs1601545088, rs1600714727, rs1371059392, rs1600767259, rs1339542565, rs1600785769, rs2065899210, rs1600732174, rs1162306056, rs879255709, rs1900111672, rs2066910297, rs1554122080, rs796052941, rs1600789325, rs2082695884, rs1737677036, rs1737495759, rs868389022, rs1737685202, rs1737672350, rs762737130 |
27466191, 7550313 |
Skeletal dysplasia |
Skeletal dysplasia |
rs121912632, rs121912633, rs121912634, rs121912636, rs121912637, rs267607147, rs387906324, rs267607150, rs397514473, rs398123438, rs515726153, rs515726154, rs515726162, rs515726163, rs515726172, rs757011098 |
|
Tumoral calcinosis |
Tumoral calcinosis |
rs104894343, rs104894344, rs745655924, rs137853086, rs375879489, rs761396172, rs137853087, rs137853091, rs137853088, rs137853089, rs137853090, rs766750282, rs760830864, rs786205250, rs267606841, rs1555096583, rs1220533001, rs762936774, rs775341386 |
21193197 |
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Anorexia |
Anorexia |
|
|
Arthropathy |
Arthropathy |
|
|
Benign hypophosphatasia |
Prenatal benign hypophosphatasia |
|
|
Clonic seizures |
Clonic Seizures |
|
27466191, 7550313 |
Dolichocephaly |
Long narrow head |
|
|
Dwarfism |
Dwarfism |
|
|
Frontal bossing |
Frontal bossing |
|
|
Hypotonic seizures |
Epileptic drop attack |
|
7550313, 27466191 |
Jacksonian seizure |
Jacksonian Seizure |
|
27466191, 7550313 |
Kidney stone |
Kidney Calculi |
|
26272126 |
Lethal hypophosphatasia |
Perinatal lethal hypophosphatasia |
|
|
Metabolic bone disorder |
Metabolic Bone Disorder |
|
26773408 |
Micromelia |
Micromelia |
|
|
Nephrocalcinosis |
Nephrocalcinosis |
|
|
Osteopenia |
Osteopenia |
|
26773408 |
Proptosis |
Exophthalmos |
|
|
Rachitic rosary |
Rachitic rosary |
|
|
Rickets |
Rickets, Adult Rickets |
|
|
|
|
|