HARS2 (histidyl-tRNA synthetase 2, mitochondrial)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
23438 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Histidyl-tRNA synthetase 2, mitochondrial |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
HARS2 |
SynonymsGene synonyms aliases
|
HARSL, HARSR, HO3, HisRS, PRLTS2 |
ChromosomeChromosome number
|
5 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
5q31.3 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is an enzyme belonging to the class II family of aminoacyl-tRNA synthetases. Functioning in the synthesis of histidyl-tran |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs61736946 |
G>C |
Benign, conflicting-interpretations-of-pathogenicity |
Coding sequence variant, missense variant |
rs140540222 |
C>T |
Uncertain-significance, likely-pathogenic |
Missense variant, coding sequence variant, intron variant, 5 prime UTR variant |
rs200089613 |
G>A,T |
Likely-benign, likely-pathogenic |
Missense variant, coding sequence variant |
rs376177973 |
G>A,T |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs397515410 |
C>G |
Pathogenic-likely-pathogenic |
Coding sequence variant, missense variant, 5 prime UTR variant |
rs754069818 |
C>T |
Likely-pathogenic |
Missense variant, coding sequence variant, 5 prime UTR variant |
rs778499309 |
G>A,C |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs863224040 |
G>A |
Pathogenic |
Splice donor variant |
rs973137103 |
A>G |
Likely-pathogenic |
Missense variant, coding sequence variant, 5 prime UTR variant |
rs1432653451 |
G>A |
Likely-pathogenic |
Coding sequence variant, missense variant, intron variant, 5 prime UTR variant |
rs1581550832 |
T>GTATCCCTAGTATTTCTACTA |
Likely-pathogenic |
Inframe insertion, coding sequence variant, stop gained |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P49590 |
Protein name |
Histidine--tRNA ligase, mitochondrial (EC 6.1.1.21) (Histidine--tRNA ligase-like) (Histidyl-tRNA synthetase) (HisRS) |
Protein function |
Mitochondrial aminoacyl-tRNA synthetase that catalyzes the ATP-dependent ligation of histidine to the 3'-end of its cognate tRNA, via the formation of an aminoacyl-adenylate intermediate (His-AMP). |
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF13393 |
tRNA-synt_His |
62 → 390 |
Histidyl-tRNA synthetase |
Domain |
PF03129 |
HGTP_anticodon |
411 → 502 |
Anticodon binding domain |
Domain |
|
Sequence |
|
Sequence length |
506 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Hearing loss |
Sensorineural Hearing Loss (disorder) |
rs267607135, rs267606855, rs779841884, rs267606854, rs28942097, rs121908073, rs121908076, rs74315289, rs121908144, rs111033313, rs74315437, rs121908348, rs121908349, rs121908350, rs397515359, rs180177151, rs180177154, rs180177153, rs35689081, rs35887622, rs80338944, rs104894396, rs104894398, rs80338947, rs80338948, rs80338942, rs104894402, rs104894403, rs80338945, rs28931594, rs80338940, rs80338941, rs80356590, rs80338950, rs387906706, rs387906707, rs387906708, rs398122848, rs387907016, rs587776894, rs387907088, rs397515411, rs370965183, rs398122930, rs199897298, rs111033187, rs111033448, rs199606180, rs111033284, rs397516413, rs111033305, rs111033220, rs111033256, rs111033297, rs111033253, rs104894408, rs111033295, rs397516874, rs76434661, rs111033335, rs397517323, rs111033247, rs367928692, rs374793617, rs143939430, rs397515605, rs80338939, rs200656442, rs779748859, rs587781261, rs587781262, rs143343083, rs200147906, rs730880338, rs797044491, rs146281367, rs756484720, rs869025593, rs201306709, rs540895576, rs777777359, rs879255246, rs1554358720, rs142498437, rs377145777, rs1057517519, rs779077039, rs952741388, rs1060499797, rs764139009, rs1060499590, rs1064794012, rs1064797115, rs756790858, rs775633137, rs1554952443, rs1554952193, rs782063761, rs1199012623, rs756147087, rs1555648043, rs1555661490, rs1553196233, rs781546107, rs111033190, rs775428246, rs782539587, rs537227442, rs148695069, rs1554835827, rs953422571, rs1554834186, rs1554834161, rs1554835103, rs1554577339, rs1554577402, rs768471577, rs782279338, rs781951909, rs998045226, rs375759781, rs755804651, rs1557458426, rs767797828, rs538027448, rs1559366084, rs367688416, rs1558480402, rs1558490542, rs1559870857, rs1560690591, rs1561299289, rs1562817224, rs1562817529, rs1562822565, rs1562835391, rs1564113368, rs1564554255, rs773851192, rs1564555240, rs761261855, rs1564805114, rs1565522273, rs1565127413, rs781790246, rs1565430886, rs1565469959, rs746667217, rs1565819402, rs1565855932, rs150529554, rs1567939793, rs201866631, rs754472294, rs1559372512, rs1558464965, rs1558488902, rs775062249, rs1226171550, rs1561590396, rs765574676, rs762876554, rs757327146, rs1564949059, rs1565519673, rs368050948, rs1565541888, rs781989117, rs1565402473, rs750358148, rs1386887007, rs1209665716, rs1567641234, rs1237955948, rs1569042782, rs752672077, rs146689036, rs1560070780, rs149712664, rs1564556995, rs762226905, rs773573968, rs1568528171, rs1198256157, rs377267777, rs370564476, rs1577876794, rs747787770, rs759432278, rs1043716893, rs1581138934, rs2033773650, rs1421964916, rs771766431, rs780917129, rs1895773215, rs1895769400, rs761543680, rs1565920060 |
|
Perrault syndrome |
PERRAULT SYNDROME 2, Perrault syndrome |
rs397515410, rs398123033, rs398123034, rs398123035, rs199589947, rs398123036, rs398123037, rs587777443, rs786205560, rs786205574, rs775766910, rs864309643, rs376177973, rs201392711, rs1131692170, rs776171893, rs774649299, rs766199971, rs1555719766, rs1559484149, rs1562047621, rs754069818, rs778499309, rs1169927428, rs1038744864, rs536853368, rs770440975, rs1575292827, rs1599193093, rs2091852209 |
21464306, 27650058, 28263850, 31449985 |
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Gonadal dysgenesis |
Gonadal dysgenesis XX type deafness |
|
21464306 |
|
|
|