OBSL1 (obscurin like cytoskeletal adaptor 1)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
23363 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Obscurin like cytoskeletal adaptor 1 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
OBSL1 |
SynonymsGene synonyms aliases
|
- |
ChromosomeChromosome number
|
2 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
2q35 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
Cytoskeletal adaptor proteins function in linking the internal cytoskeleton of cells to the cell membrane. This gene encodes a cytoskeletal adaptor protein, which is a member of the Unc-89/obscurin family. The protein contains multiple N- and C-terminal i |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs79295927 |
G>A |
Uncertain-significance, conflicting-interpretations-of-pathogenicity |
Coding sequence variant, missense variant |
rs121918215 |
G>T |
Pathogenic |
Stop gained, coding sequence variant |
rs121918216 |
G>A,C,T |
Pathogenic |
Synonymous variant, stop gained, coding sequence variant, missense variant |
rs146306059 |
G>A |
Conflicting-interpretations-of-pathogenicity |
Coding sequence variant, synonymous variant |
rs149009269 |
C>T |
Conflicting-interpretations-of-pathogenicity |
Coding sequence variant, synonymous variant |
rs201893489 |
G>A,T |
Uncertain-significance, conflicting-interpretations-of-pathogenicity |
Coding sequence variant, genic downstream transcript variant, synonymous variant, missense variant |
rs760929207 |
ACCTTTGACTG>- |
Likely-pathogenic |
Coding sequence variant, splice donor variant, intron variant |
rs762334954 |
->T |
Pathogenic |
Frameshift variant, coding sequence variant |
rs775172922 |
C>G |
Likely-pathogenic |
Intron variant |
rs775865076 |
G>A |
Pathogenic |
Coding sequence variant, stop gained |
rs780389591 |
G>A,T |
Likely-pathogenic |
Coding sequence variant, stop gained, synonymous variant |
rs886041519 |
C>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1057518716 |
A>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1057518717 |
G>A |
Pathogenic |
Stop gained, coding sequence variant, intron variant, genic downstream transcript variant |
rs1335171880 |
CACGGTGCGC>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1449351602 |
G>- |
Likely-pathogenic |
Coding sequence variant, genic downstream transcript variant, frameshift variant, intron variant |
rs1553537027 |
ATGAGTCTGTGCTGCAGACCCTTCTGCTCTATACGGTACCGCAGGGCCCCAGG>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1559155800 |
C>T |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1559155954 |
->A |
Likely-pathogenic |
Coding sequence variant, stop gained |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
O75147 |
Protein name |
Obscurin-like protein 1 |
Protein function |
Core component of the 3M complex, a complex required to regulate microtubule dynamics and genome integrity. It is unclear how the 3M complex regulates microtubules, it could act by controlling the level of a microtubule stabilizer (PubMed:247936 |
PDB |
2CPC
,
2E6P
,
2E6Q
,
2LU7
,
2LVC
,
2WP3
,
2WWK
,
2WWM
,
3KNB
,
5FM5
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF07679 |
I-set |
12 → 101 |
Immunoglobulin I-set domain |
Domain |
PF07679 |
I-set |
128 → 226 |
Immunoglobulin I-set domain |
Domain |
PF07679 |
I-set |
248 → 336 |
Immunoglobulin I-set domain |
Domain |
PF07679 |
I-set |
341 → 426 |
Immunoglobulin I-set domain |
Domain |
PF07679 |
I-set |
720 → 795 |
Immunoglobulin I-set domain |
Domain |
PF07679 |
I-set |
813 → 893 |
Immunoglobulin I-set domain |
Domain |
PF07679 |
I-set |
908 → 984 |
Immunoglobulin I-set domain |
Domain |
PF13927 |
Ig_3 |
1077 → 1157 |
|
Domain |
PF07679 |
I-set |
1174 → 1262 |
Immunoglobulin I-set domain |
Domain |
PF07679 |
I-set |
1273 → 1348 |
Immunoglobulin I-set domain |
Domain |
PF07679 |
I-set |
1360 → 1445 |
Immunoglobulin I-set domain |
Domain |
PF07679 |
I-set |
1449 → 1529 |
Immunoglobulin I-set domain |
Domain |
PF07679 |
I-set |
1629 → 1715 |
Immunoglobulin I-set domain |
Domain |
PF07679 |
I-set |
1719 → 1796 |
Immunoglobulin I-set domain |
Domain |
PF07679 |
I-set |
1809 → 1892 |
Immunoglobulin I-set domain |
Domain |
|
Sequence |
|
Sequence length |
1896 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
3m syndrome |
Miller-McKusick-Malvaux-Syndrome (3M Syndrome), Three M Syndrome 2, 3M syndrome |
rs121918215, rs1335171880, rs121918216, rs121918228, rs121918229, rs730880261, rs730880262, rs730880263, rs752254407, rs1568590155, rs201406974, rs786205651, rs61752334, rs762334954, rs749509661, rs864309521, rs886042376, rs748555538, rs1057518716, rs1064792895, rs775865076, rs1554138553, rs746333044, rs1553538488, rs760910667, rs1561875767, rs1561892336, rs1561898352, rs760929207, rs1559155954, rs1561873941, rs1561881909, rs1559160379, rs1023630527, rs766471384, rs1581962986, rs1581930130, rs773698181 |
30980518, 19877176, 25923536, 19481195, 21737058 |
Macrocephaly |
Relative macrocephaly |
rs786204854, rs764333096, rs1557739557 |
|
Scoliosis |
Scoliosis, unspecified |
rs1057518828, rs147296805, rs758163506, rs1555613564, rs1596852902, rs1596853067, rs1596853085 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Camptodactyly of fingers |
Clinodactyly of the 5th finger |
|
30980518 |
Developmental dysplasia of the hip |
Congenital Dysplasia Of The Hip |
|
|
Dolichocephaly |
Long narrow head |
|
30980518 |
Dwarfism |
Dwarfism |
|
|
Frontal bossing |
Frontal bossing |
|
30980518 |
High palate |
Byzanthine arch palate |
|
|
Hypospadias |
Hypospadias |
|
|
Micromelia |
Micromelia |
|
|
Vertical talus |
Vertical Talus |
|
|
|
|
|
| © 2021, Biomedical Informatics Centre, NIRRH |
ICMR-National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400012
Tel: +91-22-24192104, Fax No: +91-22-24139412 |