DVL3 (dishevelled segment polarity protein 3)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
1857 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Dishevelled segment polarity protein 3 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
DVL3 |
SynonymsGene synonyms aliases
|
DRS3 |
ChromosomeChromosome number
|
3 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
3q27.1 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene is a member of a multi-gene family which shares strong similarity with the Drosophila dishevelled gene, dsh. The Drosophila dishevelled gene encodes a cytoplasmic phosphoprotein that regulates cell proliferation. [provided by RefSeq, Jul 2008] |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs753876000 |
G>A,T |
Likely-pathogenic |
5 prime UTR variant, coding sequence variant, missense variant |
rs869025215 |
G>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs869025216 |
A>C,G |
Pathogenic |
Splice acceptor variant |
rs869025217 |
G>A,C |
Pathogenic, likely-pathogenic |
Splice acceptor variant |
rs869025218 |
C>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs869025219 |
C>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1553811652 |
G>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
rs1577052471 |
C>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1577052755 |
TGGCTCCAACCGTAGCGGCAGCGAT>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1577052785 |
ATCG>- |
Pathogenic |
Frameshift variant, coding sequence variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
GO ID |
Ontology |
Definition |
Evidence |
Reference |
GO:0000785 |
Component |
Chromatin |
IDA |
21880741 |
GO:0001934 |
Process |
Positive regulation of protein phosphorylation |
IMP |
20137080 |
GO:0002020 |
Function |
Protease binding |
IPI |
20227366 |
GO:0005102 |
Function |
Signaling receptor binding |
IPI |
17030191 |
GO:0005109 |
Function |
Frizzled binding |
IBA |
21873635 |
GO:0005109 |
Function |
Frizzled binding |
IPI |
19388021 |
GO:0005109 |
Function |
Frizzled binding |
TAS |
25424568 |
GO:0005515 |
Function |
Protein binding |
IPI |
10330181, 10644691, 11113207, 12805222, 15677333, 16189514, 17030191, 19465938, 19625296, 20412773, 20439735, 21880741, 22863007, 23109420, 25416956, 25557784, 25910212, 26359454, 28514442, 32296183, 32814053 |
GO:0005829 |
Component |
Cytosol |
IBA |
21873635 |
GO:0005829 |
Component |
Cytosol |
IDA |
23109420 |
GO:0005829 |
Component |
Cytosol |
TAS |
|
GO:0008013 |
Function |
Beta-catenin binding |
IDA |
10644691, 21880741 |
GO:0031267 |
Function |
Small GTPase binding |
IPI |
23109420 |
GO:0035556 |
Process |
Intracellular signal transduction |
IEA |
|
GO:0035567 |
Process |
Non-canonical Wnt signaling pathway |
IMP |
19137009 |
GO:0035567 |
Process |
Non-canonical Wnt signaling pathway |
TAS |
25424568 |
GO:0038031 |
Process |
Non-canonical Wnt signaling pathway via JNK cascade |
ISS |
|
GO:0042493 |
Process |
Response to drug |
IEA |
|
GO:0043507 |
Process |
Positive regulation of JUN kinase activity |
IMP |
19137009 |
GO:0043547 |
Process |
Positive regulation of GTPase activity |
IDA |
23109420 |
GO:0045893 |
Process |
Positive regulation of transcription, DNA-templated |
IDA |
10644691, 17593335 |
GO:0045944 |
Process |
Positive regulation of transcription by RNA polymerase II |
IDA |
12805222 |
GO:0050821 |
Process |
Protein stabilization |
IGI |
26359454 |
GO:0060070 |
Process |
Canonical Wnt signaling pathway |
IBA |
21873635 |
GO:0060070 |
Process |
Canonical Wnt signaling pathway |
IDA |
10644691, 17593335 |
GO:0060070 |
Process |
Canonical Wnt signaling pathway |
IGI |
18093802 |
GO:0060070 |
Process |
Canonical Wnt signaling pathway |
IMP |
20137080 |
GO:0060070 |
Process |
Canonical Wnt signaling pathway |
TAS |
25424568 |
GO:0060071 |
Process |
Wnt signaling pathway, planar cell polarity pathway |
IDA |
12805222 |
GO:0060071 |
Process |
Wnt signaling pathway, planar cell polarity pathway |
NAS |
24431302 |
GO:0090090 |
Process |
Negative regulation of canonical Wnt signaling pathway |
TAS |
|
GO:0090179 |
Process |
Planar cell polarity pathway involved in neural tube closure |
IBA |
21873635 |
GO:0150012 |
Process |
Positive regulation of neuron projection arborization |
ISS |
|
GO:1903827 |
Process |
Regulation of cellular protein localization |
IDA |
19625296 |
GO:1904886 |
Process |
Beta-catenin destruction complex disassembly |
TAS |
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
Q92997 |
Protein name |
Segment polarity protein dishevelled homolog DVL-3 (Dishevelled-3) (DSH homolog 3) |
Protein function |
Involved in the signal transduction pathway mediated by multiple Wnt genes. |
PDB |
6V7O
,
6ZBQ
,
6ZBZ
,
6ZC3
,
6ZC4
,
6ZC6
,
6ZC7
,
6ZC8
,
8S6A
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF00778 |
DIX |
2 → 80 |
DIX domain |
Family |
PF02377 |
Dishevelled |
87 → 245 |
Dishevelled specific domain |
Family |
PF00595 |
PDZ |
249 → 334 |
PDZ domain |
Domain |
PF00610 |
DEP |
425 → 494 |
Domain found in Dishevelled, Egl-10, and Pleckstrin (DEP) |
Domain |
PF12316 |
Dsh_C |
500 → 706 |
Segment polarity protein dishevelled (Dsh) C terminal |
Family |
|
Sequence |
|
Sequence length |
716 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Brachydactyly |
Brachydactyly |
rs121908949, rs28937580, rs121909082, rs104894122, rs863223289, rs863223290, rs104894121, rs1587657302, rs863223292, rs74315386, rs74315387, rs28936397, rs753691079, rs121909348, rs121917852, rs121917853, rs121917854, rs121917855, rs121917859, rs121917861, rs267606873, rs267606872, rs267606985, rs267606986, rs267606987, rs267606988, rs28933082, rs397514519, rs869025613, rs869025614, rs886039878, rs1553540620, rs1057518333, rs1948841937, rs1948868228, rs1948842030, rs1948842142 |
|
Breast cancer |
Malignant neoplasm of breast |
rs587776547, rs1137887, rs137853007, rs587776650, rs80359351, rs80359714, rs121917783, rs104886456, rs121964878, rs80359874, rs80357868, rs80357508, rs387906843, rs80357569, rs80358158, rs80357524, rs80357115, rs80357945, rs80357729, rs80357609, rs80357259, rs80357981, rs80358063, rs80357389, rs80356862, rs80359876, rs80357580, rs80358053, rs80358089, rs80187739, rs397507241, rs80358069, rs80357590, rs80357284, rs80357941, rs80359261, rs80359272, rs80359276, rs276174813, rs80358474, rs80359316, rs1555282969, rs80359388, rs80359499, rs80359505, rs80359520, rs80359526, rs80359533, rs56253082, rs80358824, rs80359554, rs80359636, rs80359651, rs80359659, rs80359011, rs80359012, rs80359013, rs80359718, rs397507410, rs81002812, rs80359730, rs80359152, rs80359159, rs397507419, rs28897759, rs80359211, rs80359775, rs397514577, rs397507584, rs80358435, rs80358456, rs80359340, rs80359343, rs80359365, rs80358579, rs397507670, rs80358593, rs80359406, rs80359444, rs80359454, rs276174853, rs276174854, rs80359483, rs80359537, rs80358815, rs80358843, rs80359558, rs80359560, rs80359594, rs80358893, rs28897743, rs397507900, rs397507906, rs397507918, rs80358971, rs80358981, rs397507941, rs80359030, rs80359035, rs41293511, rs397507396, rs81002806, rs80359112, rs397508006, rs81002893, rs45580035, rs80359760, rs397508051, rs80359772, rs4987049, rs80359777, rs80357770, rs397508867, rs62625303, rs397508874, rs80357506, rs80357287, rs273898674, rs80358042, rs80358083, rs80357058, rs41286296, rs80357960, rs80356945, rs80357223, rs386134270, rs80358116, rs80357856, rs80357424, rs397509050, rs80357485, rs80357966, rs397509067, rs80357310, rs80356866, rs80357260, rs80357437, rs80358023, rs80358086, rs80357133, rs80356993, rs80357997, rs80357239, rs80357227, rs397509243, rs80356969, rs80356959, rs63750617, rs63751319, rs587779315, rs200640585, rs398122546, rs80357543, rs398122687, rs80359328, rs398122779, rs398122783, rs62517194, rs80358029, rs515726060, rs180177103, rs180177111, rs180177133, rs587776527, rs180177135, rs180177136, rs515726117, rs587779813, rs587779909, rs587780024, rs587780100, rs28909982, rs121908698, rs180177100, rs587780210, rs587780240, rs587780639, rs587781269, rs587781353, rs587781471, rs587781658, rs587781697, rs587781730, rs587781894, rs587781948, rs587782005, rs587782011, rs200928781, rs587781558, rs370228071, rs587782245, rs587782401, rs180177110, rs587782504, rs72552322, rs587782531, rs587782620, rs587782680, rs587782774, rs587782818, rs730881411, rs730881389, rs564652222, rs397507768, rs587776419, rs730881868, rs730881940, rs56383036, rs758972589, rs201089102, rs730881348, rs786202608, rs786201886, rs786203318, rs786203775, rs786203714, rs786202033, rs750621215, rs786203884, rs786203650, rs772821016, rs863224521, rs864622223, rs864622655, rs375699023, rs876659572, rs768362387, rs876659535, rs876658957, rs483353072, rs876659435, rs267608041, rs876661113, rs730881369, rs878853535, rs772228129, rs878855122, rs760551339, rs80359596, rs397509222, rs886039630, rs886039683, rs886040828, rs587781799, rs886040374, rs886040649, rs397507967, rs878854957, rs886040043, rs1057517589, rs1060502769, rs866380588, rs863224765, rs1064793243, rs747563556, rs1555074976, rs1064795885, rs753961188, rs1064794708, rs869312772, rs1064793887, rs1131690820, rs1135401928, rs1135401868, rs1135401859, rs1553370324, rs397507630, rs1555283160, rs1555283251, rs1555283262, rs1555283361, rs1555286298, rs1555288462, rs886040950, rs1555289566, rs776323117, rs80357123, rs1555579627, rs1555580697, rs80358054, rs1555593302, rs1328985852, rs763470424, rs1555139694, rs878854697, rs1555461217, rs1555461765, rs774684620, rs766416564, rs1554558613, rs1305740166, rs1555461460, rs1555461407, rs1555461586, rs1555567202, rs1555607022, rs1555069815, rs1442299125, rs1474786480, rs1555084947, rs1555457867, rs141087784, rs1482641121, rs1564830522, rs1565469955, rs1565503137, rs864622613, rs755263466, rs757679199, rs1593903166, rs1597801649, rs1603293306, rs879253880, rs80358754, rs1597062038, rs45494092, rs1603275367, rs887358871, rs1597091518, rs1966967065, rs1064793049, rs2082872908, rs2085078278, rs2072475243 |
|
Cryptorchidism |
Cryptorchidism |
rs121912555, rs104894697, rs104894698, rs398122886 |
|
Developmental delay |
Global developmental delay |
rs28941770, rs199469464, rs281865469, rs143747297, rs398123009, rs587777428, rs786205133, rs606231459, rs797044854, rs797045027, rs864309504, rs878853160, rs886039902, rs886042046, rs886041291, rs886041382, rs1057518991, rs1057518699, rs753254213, rs748294403, rs762552974, rs1135401795, rs1553121073, rs1553122926, rs1364690005, rs1554086554, rs1554210415, rs1554168326, rs1554776342, rs1553873247, rs1567860112, rs779009256, rs1557447255, rs1564568350, rs780011005, rs1597464953, rs1200336864, rs1569513017, rs1587459606, rs1570332505, rs748888652, rs1575155995, rs2087029320, rs1589669105, rs1601769604, rs1184981709, rs749201074 |
|
Macrocephaly |
Macrocephaly |
rs786204854, rs764333096, rs1557739557 |
|
Mental retardation |
Intellectual Disability |
rs5742905, rs267607136, rs267607137, rs2131714307, rs267607038, rs267607042, rs80338685, rs137853127, rs80338815, rs28940893, rs387906309, rs121908096, rs121908099, rs587784365, rs121918315, rs121918316, rs397515320, rs121434489, rs1585215916, rs267607233, rs267606752, rs137852214, rs606231193, rs132630297, rs80338758, rs137852815, rs122455132, rs28935171, rs122453113, rs122445108, rs28934904, rs28934908, rs28935468, rs61748421, rs121918624, rs202060209, rs80338708, rs113994198, rs199422192, rs387906635, rs1554770064, rs1057519611, rs1060499526, rs387906636, rs1057519612, rs281875189, rs281875322, rs387906799, rs387906804, rs875989800, rs797045262, rs387906845, rs387906846, rs876657378, rs281875227, rs281875228, rs281875229, rs281875230, rs387906861, rs370667926, rs387906932, rs387906943, rs1557612719, rs387907190, rs387907191, rs2126499522, rs587776908, rs1560982564, rs80359505, rs398123009, rs587776929, rs587776930, rs397514555, rs398122824, rs398122825, rs397514556, rs2147483647, rs587776937, rs397514627, rs397514655, rs397514656, rs730882192, rs1587520018, rs1581995953, rs1554121970, rs1581987445, rs397514670, rs376395543, rs137854128, rs397509411, rs397509412, rs397514741, rs398122394, rs879255516, rs397518483, rs398122406, rs398122412, rs398123561, rs200667343, rs587777162, rs587777202, rs62507350, rs587777219, rs587777225, rs587777226, rs587779750, rs587777326, rs587777334, rs281875332, rs587780470, rs587780474, rs587780486, rs587777378, rs587777406, rs587777408, rs587777409, rs587777411, rs587777522, rs527236034, rs527236035, rs267608571, rs267608382, rs267608597, rs61753979, rs61751444, rs267608493, rs587777644, rs587777645, rs587777646, rs587777703, rs587779388, rs606231266, rs606231267, rs672601340, rs606231268, rs672601341, rs606231269, rs672601342, rs606231270, rs606231271, rs606231272, rs606231273, rs587784566, rs587784092, rs587783749, rs587783747, rs587783640, rs587783483, rs606231456, rs606231457, rs606231458, rs606231459, rs672601370, rs672601369, rs672601371, rs672601367, rs672601366, rs672601365, rs672601364, rs672601363, rs672601362, rs672601376, rs672601377, rs672601378, rs724159949, rs724159950, rs724159948, rs724159956, rs724159953, rs727502860, rs727502861, rs730882197, rs749995448, rs786205143, rs794726770, rs1135401808, rs786205583, rs786205595, rs786205859, rs794727792, rs794727928, rs794729221, rs797044519, rs797044523, rs797044521, rs797044524, rs797044526, rs797044522, rs797044520, rs794727642, rs796052719, rs781746113, rs796052510, rs796052733, rs796052724, rs796052728, rs796052676, rs796053353, rs796053366, rs796053368, rs1555103986, rs1555110818, rs796052571, rs1555110843, rs796052626, rs796052618, rs796053290, rs796052217, rs672601368, rs797045164, rs797044961, rs797044962, rs200070245, rs797044963, rs869320675, rs869320676, rs797045012, rs752746786, rs797044885, rs797044925, rs797044854, rs797044849, rs797044930, rs797044901, rs797044918, rs797044884, rs797045177, rs797045178, rs797045050, rs797045036, rs797045053, rs797045047, rs797045037, rs797045042, rs797045041, rs879255261, rs782397980, rs797045263, rs797045264, rs797045655, rs797045586, rs545185248, rs797046031, rs797046028, rs797046029, rs797046030, rs797045249, rs797045529, rs797045952, rs797045984, rs797045540, rs797045539, rs797045989, rs863224930, rs869025202, rs863225264, rs863225077, rs876661308, rs869025222, rs864309560, rs758252808, rs745756308, rs869025286, rs869025287, rs869025578, rs143038880, rs869025579, rs869025580, rs869025581, rs869312704, rs869312674, rs869312677, rs869312689, rs869312693, rs869312698, rs869312708, rs869312711, rs869312826, rs869312825, rs869312824, rs869312823, rs758432471, rs869312821, rs761993070, rs869312844, rs869312842, rs869312843, rs869312841, rs869312847, rs869320632, rs869312955, rs773432002, rs869320713, rs869320772, rs869320773, rs879255270, rs875989848, rs875989849, rs1716457622, rs2108414289, rs878854401, rs875989786, rs1085307109, rs1085307108, rs876657679, rs876661167, rs876661076, rs876661055, rs876661219, rs876661064, rs876661151, rs876661041, rs200440467, rs876661295, rs878853045, rs878853143, rs878853142, rs878853149, rs1555910048, rs878853152, rs878853146, rs878853145, rs878853141, rs878853151, rs878853144, rs878853148, rs878853147, rs878853251, rs878853269, rs879253762, rs886037841, rs879253888, rs879253931, rs879254016, rs879255618, rs879255619, rs879255620, rs886037847, rs879255621, rs886039332, rs746177928, rs886039520, rs886041003, rs886041058, rs750035706, rs886041059, rs886041060, rs886041061, rs886041090, rs886041088, rs886041089, rs886041095, rs886041097, rs886041989, rs886041944, rs886041692, rs886041593, rs886041687, rs886041207, rs886041309, rs886041239, rs886041448, rs138336847, rs149644940, rs886041295, rs886041521, rs886041125, rs886042041, rs886041238, rs886041469, rs886041197, rs886041291, rs886041658, rs886041705, rs886041876, rs139716296, rs1057516030, rs1057517408, rs749655461, rs141179774, rs370916968, rs1057517676, rs1057517933, rs1057517708, rs1057518352, rs1057518183, rs1057518474, rs1057518204, rs1057517825, rs1057518796, rs1057518961, rs1057518772, rs1057518988, rs1057519004, rs1057518700, rs772450541, rs371310428, rs1057519019, rs1057519491, rs1057519546, rs1057519560, rs1057519565, rs1057519400, rs1057519402, rs1057519405, rs1057519593, rs1057519594, rs1057519628, rs1556912828, rs1060505029, rs1060505030, rs147001633, rs1057519947, rs1057519617, rs1057524832, rs774592932, rs797045045, rs1039571136, rs1555910821, rs1060499626, rs1060499655, rs1554770185, rs1060499936, rs1060501153, rs1060501151, rs1064792984, rs1060503378, rs1060503386, rs1060503383, rs1060500046, rs1064792999, rs1060505033, rs1064796564, rs1064797002, rs1064793161, rs150802299, rs1064796830, rs1064794996, rs1064795444, rs1064796034, rs1064796403, rs1064794979, rs1064796765, rs1064793539, rs760933323, rs1064793546, rs1064796406, rs1064796367, rs780441716, rs1064794894, rs1064796023, rs1064797355, rs1085307484, rs1064794935, rs1085307547, rs1131690804, rs757511770, rs1131691875, rs1131691979, rs398122823, rs1131691866, rs1131692159, rs1131692228, rs1131692154, rs113331868, rs1554121872, rs1554121875, rs926027867, rs1554122123, rs1554122129, rs1287121256, rs1554122526, rs1554123982, rs1554385102, rs1554385111, rs1554385305, rs1554386687, rs1554389088, rs1554402092, rs1554434435, rs1135401778, rs1135401760, rs1135401770, rs1135401771, rs1135401768, rs1135401779, rs1135401805, rs1135401797, rs1135401799, rs1135401816, rs1135401823, rs1135401824, rs1555769968, rs1135401825, rs1135401955, rs1135401956, rs1135401957, rs1135401958, rs1554129040, rs1554150543, rs1553188463, rs1553146165, rs1485978447, rs1361547443, rs750079325, rs369692236, rs1554231836, rs749188610, rs1554122735, rs1554689877, rs1174482090, rs781053477, rs1554623112, rs1555409836, rs1555411305, rs770014321, rs1555984461, rs1555990958, rs762292772, rs1554944271, rs1057524157, rs1485749468, rs1555984343, rs1293450628, rs373584239, rs1553722309, rs1553738686, rs1376334317, rs1553722294, rs1553283831, rs1554120589, rs1555985554, rs1555877287, rs1555411378, rs750922282, rs1553264873, rs1554263326, rs1554264268, rs1554263626, rs1554263625, rs766614772, rs1553620494, rs1555050158, rs1555050165, rs1555050171, rs1555050174, rs765556214, rs1402086660, rs1554645052, rs1555661648, rs1293246328, rs749494995, rs775592405, rs1553265189, rs1553242856, rs1553247374, rs1553241570, rs1553997065, rs1553998565, rs1380822792, rs1555028154, rs1555023232, rs1553194155, rs1553130904, rs1553152590, rs1553567864, rs1553638614, rs120074160, rs1554486894, rs1554767754, rs1554843977, rs1555443581, rs1555443600, rs1555439545, rs1555525088, rs770680174, rs1555889130, rs373178770, rs1555985532, rs1553519853, rs781325598, rs1410587479, rs1553638086, rs150259543, rs1554093891, rs1554121228, rs1554120498, rs1554121189, rs1212517874, rs1554770628, rs1555979158, rs1554770054, rs771610568, rs1451230055, rs1554770624, rs1555906707, rs1555906768, rs1555906781, rs1555907620, rs1555907623, rs1555907626, rs1555907653, rs1555907864, rs1554094145, rs1554202698, rs1554200722, rs773327091, rs1555607621, rs1555604778, rs1555607159, rs1555607682, rs1553364018, rs1553324416, rs1555411394, rs1554102556, rs1554122363, rs1555705966, rs1555103971, rs1555408401, rs1554461593, rs1554304254, rs1554120978, rs1047509819, rs1555982601, rs767774867, rs1554789246, rs1555111511, rs1555950676, rs1555954380, rs1555985649, rs1553194162, rs1553518509, rs1274633498, rs1554274371, rs1554122252, rs1554122458, rs1554122729, rs1554297905, rs1554776342, rs1554770046, rs1554770667, rs1554792556, rs1452715535, rs1555444885, rs1555534147, rs1427624649, rs1555611722, rs1555744282, rs1555706391, rs1178702025, rs1555984102, rs1554770589, rs1554121443, rs1559791842, rs1559824939, rs1555889127, rs1236702036, rs1553510280, rs1553511175, rs1553511226, rs1554150552, rs1554275163, rs1554201137, rs1553517991, rs1553518511, rs1553517984, rs1553518752, rs1554119814, rs1554122293, rs1554122341, rs1554122689, rs1554770243, rs1554770444, rs1557045250, rs959316981, rs1556270312, rs1553270640, rs978179634, rs1554093884, rs1491240980, rs1555943484, rs1554121453, rs1334099693, rs1554048616, rs1555660806, rs1555644480, rs1555651572, rs1567844992, rs1567855081, rs1567855669, rs1567855704, rs1567856045, rs1567856331, rs1567860075, rs1567860112, rs1567860640, rs1567860891, rs754919272, rs1567860919, rs1567861468, rs1567861489, rs1567861501, rs1567861894, rs1567863732, rs1567864750, rs1567877108, rs1567878511, rs758785463, rs1553808301, rs1553245038, rs1553789166, rs1553813646, rs1553631860, rs1554121265, rs1554770262, rs1555034768, rs1555984433, rs779009256, rs1553994814, rs1553996086, rs1553996072, rs1553270599, rs1553153291, rs760262127, rs1554119274, rs1554121878, rs1554387293, rs1554385203, rs757077698, rs750612085, rs1554776500, rs1564360978, rs1554776933, rs1554776938, rs1565278132, rs1567368243, rs1558478047, rs375695605, rs1558479778, rs1558501648, rs1565240833, rs114727354, rs1557591264, rs1557620758, rs1559099927, rs1561788984, rs369459721, rs1563831738, rs1562159088, rs1562159562, rs1562159599, rs1559094754, rs1559328283, rs755634856, rs1561784687, rs1554122296, rs1561789313, rs1562720119, rs1564363665, rs1561697465, rs1561785003, rs1561787845, rs1561789215, rs1554122305, rs1561784553, rs1561784560, rs1561787690, rs1554122888, rs749632782, rs1567139896, rs1569370887, rs1569371303, rs1564493599, rs1561875779, rs1569146542, rs1569146649, rs1275489527, rs1560115921, rs1468772495, rs749969789, rs1560108090, rs1569376809, rs1569355102, rs1560103306, rs1564365418, rs1559855453, rs1562928193, rs1558149913, rs1253072668, rs141976414, rs1558371790, rs1557898800, rs1567758622, rs1567844041, rs1567844114, rs1567920106, rs1567920209, rs138247472, rs1567974030, rs1567995650, rs1283838287, rs1568003569, rs1568006217, rs1568018905, rs1562505675, rs1561783309, rs1555980234, rs1559087186, rs1560966086, rs1560330387, rs769471341, rs1562493608, rs1562505335, rs1554121861, rs1554122200, rs1562957809, rs1568097623, rs1391600900, rs1568234874, rs1568235086, rs1555990955, rs1567870541, rs1557570794, rs1562869207, rs1571818248, rs1431778557, rs369691608, rs1595808957, rs1597665063, rs1597846084, rs1603401125, rs1603350606, rs1601946481, rs1601932069, rs1602880906, rs1602308324, rs1574554519, rs1573882268, rs1603198937, rs1558148010, rs1558498928, rs1569459580, rs1569380375, rs1560062082, rs1557889974, rs1558414255, rs756429763, rs781663444, rs1569016820, rs1569017025, rs1569017160, rs1557612048, rs1568504941, rs1581987022, rs1576983339, rs1599892470, rs1265340906, rs1602284689, rs1574949440, rs1576220938, rs1576280892, rs1576288424, rs1574459612, rs1574511051, rs1575654528, rs1577094794, rs1294683568, rs771819481, rs1580984895, rs1581338441, rs1580988138, rs1581980317, rs1581986872, rs1554121207, rs1581987268, rs1581987476, rs1581987885, rs763770519, rs1581991929, rs1581992099, rs1581992998, rs1581995453, rs1554122242, rs1581996778, rs1581997228, rs1588735247, rs1555980467, rs1555985742, rs1601319086, rs1601970168, rs1574451881, rs876661168, rs1576994053, rs1573589807, rs1581036396, rs1601267617, rs1572531830, rs1573483715, rs1590954686, rs1601315812, rs1573965358, rs1573972562, rs529087882, rs1570609440, rs1598940393, rs1575333081, rs1576028676, rs1596476657, rs1599375711, rs1603290366, rs1603060007, rs1603069440, rs1592939069, rs1591612223, rs2062994512, rs373701249, rs1600471396, rs1600501018, rs1600504088, rs1600514073, rs748436953, rs765723607, rs758170522, rs1561785045, rs1357591960, rs1591609136, rs1596891223, rs1579370234, rs2047850664, rs1579109565, rs1870202051, rs1574887674, rs778229060, rs1572531281, rs1570622663, rs1573501865, rs1576086299, rs1576164991, rs1574907198, rs1576656734, rs1554121438, rs1581995425, rs1581996813, rs1582001015, rs1588324025, rs1591371152, rs1590008294, rs1590956245, rs1590028691, rs1591606580, rs1591611001, rs1591612317, rs1591612370, rs763436882, rs997044541, rs1595897117, rs747706524, rs1579377990, rs1201878175, rs1894051550, rs1572531730, rs1579576029, rs1577017863, rs752545577, rs1582461267, rs1589460606, rs1588727276, rs1598620094, rs1599368323, rs1600082188, rs1601319352, rs1598226304, rs2076013475, rs2076017638, rs1600596180, rs1554121932, rs1680676671, rs1570607996, rs1382444181, rs1570640673, rs1574994308, rs1596667777, rs1602226289, rs1595629181, rs1595609005, rs1227643933, rs1572705473, rs1570621899, rs1722830922, rs1575094649, rs1417035592, rs1581997098, rs1589457762, rs1598211790, rs758726258, rs1601071971, rs863224922, rs1586692481, rs1586692548, rs1586692551, rs1580988074, rs1594129609, rs1588732344, rs1579368865, rs1586660389, rs1586660370, rs1586660338, rs1586657848, rs1586660381, rs1791701214, rs752676391, rs1680673822, rs758098717, rs1726676630, rs762288077, rs1759964009, rs1760905766, rs1761021165, rs1554121934, rs2055849544, rs1049773, rs587784300, rs1861628072, rs1761241410, rs1064797322, rs1948652423, rs2059194330, rs1777174302, rs2054280202, rs2081190512, rs772665884, rs1400164869, rs1861593395, rs1760897843, rs1761087122, rs1388355040, rs2068797192, rs1777175608, rs376898131 |
|
Oligodontia |
Oligodontia |
rs1591901585 |
|
Patent ductus arteriosus |
Patent ductus arteriosus |
rs80338911, rs879253870, rs879253871, rs879255278, rs879255279, rs879253872 |
|
Robinow syndrome |
Robinow Syndrome, ROBINOW SYNDROME, AUTOSOMAL DOMINANT 3, ROBINOW SYNDROME, AUTOSOMAL DOMINANT 2, ROBINOW SYNDROME, AUTOSOMAL DOMINANT 1, Robinow Syndrome, Autosomal Dominant, Autosomal dominant Robinow syndrome |
rs121909083, rs121909084, rs121909085, rs121909086, rs863223291, rs121909087, rs267607016, rs387906663, rs786200925, rs786204836, rs797044837, rs797044840, rs797044833, rs797044839, rs797044838, rs797044835, rs797044834, rs797044836, rs869025220, rs869025215, rs869025216, rs869025217, rs869025218, rs869025219, rs1553173368, rs1553173367, rs1553173372, rs1553173420, rs1553811652, rs1553677971, rs1223920489, rs1555657073, rs1555657074, rs1555607285, rs1555610590, rs1568105666, rs1587655016, rs1587690611, rs1577052471, rs1569684523, rs1577052785 |
26924530, 26924530, 29575616 |
Scoliosis |
Scoliosis, unspecified |
rs1057518828, rs147296805, rs758163506, rs1555613564, rs1596852902, rs1596853067, rs1596853085 |
|
Ventricular septal defect |
Ventricular Septal Defects |
rs104894073, rs387906775 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Accessory kidney |
Accessory kidney |
|
|
Alopecia |
Alopecia |
|
|
Anodontia |
Developmental absence of tooth |
|
|
Avascular necrosis of the capital femoral epiphysis |
Avascular necrosis of the capital femoral epiphysis |
|
|
Camptodactyly of fingers |
Clinodactyly of the 5th finger |
|
|
Cardiac hypoplasia |
Hypoplasia of right heart |
|
|
Clinodactyly |
Clinodactyly of fingers, Clinodactyly |
|
|
Congenital atresia of pulmonary artery |
Congenital atresia of pulmonary artery |
|
|
Congenital epicanthus |
Congenital Epicanthus |
|
|
Congenital euryblepharon |
Congenital euryblepharon |
|
|
Congenital exomphalos |
Congenital exomphalos |
|
|
Congenital hypoplasia of penis |
Congenital hypoplasia of penis |
|
|
Congenital pectus carinatum |
Congenital pectus carinatum |
|
|
Congenital pectus excavatum |
Congenital pectus excavatum |
|
|
Dwarfism |
Dwarfism |
|
|
Epispadias |
Epispadias |
|
|
Fingernail dysplasia |
Fingernail dysplasia |
|
|
Frontal bossing |
Frontal bossing |
|
|
Hernia, femoral |
Hernia, Femoral |
|
|
High palate |
Byzanthine arch palate |
|
|
Hydronephrosis |
Hydronephrosis |
|
|
Hypodontia |
Hypodontia |
|
|
Hypospadias |
Hypospadias |
|
|
Legg-calve-perthes disease |
Legg-Calve-Perthes Disease |
|
|
Macroglossia |
Macroglossia |
|
|
Mesomelia |
Mesomelia |
|
|
Micrognathism |
Micrognathism |
|
|
Micromelia |
Micromelia |
|
|
Patent foramen ovale |
Foramen Ovale, Patent |
|
|
Penis agenesis |
Penis agenesis |
|
|
Phakomatosis pigmentovascularis |
Port-Wine Stain |
|
|
Posteriorly rotated ear |
Posteriorly rotated ear |
|
|
Proptosis |
Exophthalmos |
|
|
Ptosis |
Blepharoptosis, Ptosis |
rs139920573 |
|
Specific learning disorder |
Specific learning disability |
rs1057519497 |
|
Strabismus |
Strabismus |
|
|
Strawberry nevus of skin |
Strawberry nevus of skin |
|
|
Syndactyly of fingers |
Syndactyly of fingers |
|
|
Tricuspid valve insufficiency |
Tricuspid Valve Insufficiency |
|
|
|
|
|