CYP11B1 (cytochrome P450 family 11 subfamily B member 1)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
1584 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Cytochrome P450 family 11 subfamily B member 1 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
CYP11B1 |
SynonymsGene synonyms aliases
|
CPN1, CYP11B, FHI, P450C11 |
ChromosomeChromosome number
|
8 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
8q24.3 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein local |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs28934586 |
C>T |
Likely-pathogenic, pathogenic |
Intron variant, coding sequence variant, missense variant |
rs61751149 |
G>A,C,T |
Conflicting-interpretations-of-pathogenicity |
Coding sequence variant, synonymous variant, missense variant |
rs61752766 |
T>C |
Benign, uncertain-significance, likely-benign, conflicting-interpretations-of-pathogenicity |
Coding sequence variant, missense variant |
rs61752786 |
G>A,C,T |
Benign, likely-pathogenic, likely-benign, benign-likely-benign |
Coding sequence variant, synonymous variant, missense variant |
rs104894061 |
G>A,C,T |
Pathogenic, likely-pathogenic |
Coding sequence variant, missense variant |
rs104894062 |
C>G,T |
Pathogenic |
Coding sequence variant, missense variant |
rs104894066 |
C>T |
Pathogenic |
Coding sequence variant, stop gained |
rs104894067 |
T>C,G |
Pathogenic |
Coding sequence variant, missense variant |
rs104894068 |
G>A |
Pathogenic |
Coding sequence variant, missense variant |
rs104894069 |
G>A |
Not-provided, pathogenic |
Coding sequence variant, missense variant |
rs104894070 |
G>A,T |
Not-provided, pathogenic-likely-pathogenic, pathogenic |
Coding sequence variant, missense variant |
rs104894071 |
G>T |
Pathogenic |
Coding sequence variant, missense variant |
rs140336749 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs146124466 |
G>A |
Pathogenic |
Coding sequence variant, stop gained |
rs193922538 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs193922539 |
C>T |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs193922540 |
C>T |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs193922541 |
A>G |
Likely-pathogenic |
Splice donor variant |
rs267606755 |
A>C |
Pathogenic-likely-pathogenic |
Stop gained, intron variant, coding sequence variant |
rs367634557 |
C>T |
Likely-pathogenic |
Missense variant, intron variant, coding sequence variant |
rs387907572 |
G>A |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs387907573 |
A>G,T |
Likely-pathogenic, pathogenic |
Coding sequence variant, missense variant |
rs577022490 |
A>G,T |
Likely-pathogenic |
Splice donor variant, intron variant |
rs748867146 |
C>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs753774484 |
C>A,G,T |
Likely-pathogenic |
Coding sequence variant, synonymous variant |
rs760880418 |
G>A,T |
Likely-pathogenic |
Synonymous variant, coding sequence variant, stop gained |
rs763195324 |
G>A,T |
Likely-pathogenic |
Missense variant, coding sequence variant, stop gained |
rs764418169 |
CCAGGCTCATCCTGTGGGGATGCAGGCT>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs764598023 |
C>T |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs768007725 |
G>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
rs775128501 |
->GTGTACTGTTG |
Pathogenic, likely-pathogenic |
Frameshift variant, coding sequence variant |
rs779103938 |
C>T |
Pathogenic-likely-pathogenic, likely-pathogenic |
Missense variant, intron variant, coding sequence variant |
rs866430018 |
C>T |
Pathogenic |
Stop gained, coding sequence variant |
rs1131691992 |
G>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
rs1249087390 |
G>- |
Pathogenic |
Frameshift variant, intron variant, coding sequence variant |
rs1256580853 |
T>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1264073726 |
C>T |
Pathogenic, likely-pathogenic |
Splice donor variant |
rs1326688256 |
G>A,C |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1365173817 |
C>A,T |
Pathogenic |
Intron variant |
rs1379392398 |
->T |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1383321200 |
C>G,T |
Likely-pathogenic |
Stop gained, coding sequence variant, missense variant |
rs1456715954 |
C>T |
Likely-pathogenic |
Splice acceptor variant |
rs1554652650 |
A>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant, intron variant |
rs1554652990 |
C>G |
Likely-pathogenic |
Splice donor variant |
rs1554652998 |
C>T |
Pathogenic |
Coding sequence variant, stop gained |
rs1554652999 |
C>T |
Pathogenic |
Coding sequence variant, stop gained |
rs1554653514 |
C>G |
Likely-pathogenic |
Splice donor variant |
rs1554653520 |
C>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1554653551 |
G>A |
Likely-pathogenic |
Coding sequence variant, stop gained |
rs1554653675 |
G>A |
Likely-pathogenic |
Coding sequence variant, stop gained |
rs1554653714 |
C>T |
Likely-pathogenic |
Coding sequence variant, stop gained |
rs1563867899 |
G>A |
Pathogenic |
Coding sequence variant, intron variant, missense variant |
rs1586557065 |
T>C |
Pathogenic |
Intron variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Transcription factors
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P15538 |
Protein name |
Cytochrome P450 11B1, mitochondrial (CYP11B1) (CYPXIB1) (Cytochrome P-450c11) (Cytochrome P450C11) (Steroid 11-beta-hydroxylase, CYP11B1) (EC 1.14.15.4) |
Protein function |
A cytochrome P450 monooxygenase involved in the biosynthesis of adrenal corticoids (PubMed:12530636, PubMed:1518866, PubMed:1775135, PubMed:18215163, PubMed:23322723). Catalyzes a variety of reactions that are essential for many species, includi |
PDB |
6M7X
,
7E7F
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF00067 |
p450 |
42 → 498 |
Cytochrome P450 |
Domain |
|
Sequence |
|
Sequence length |
503 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Congenital adrenal hyperplasia |
Congenital adrenal hyperplasia, Congenital adrenal hyperplasia due to 11-Beta-hydroxylase deficiency |
rs104894069, rs1365173817, rs104894070, rs556794126, rs104894138, rs104894139, rs104894149, rs104894142, rs104894153, rs6471, rs7769409, rs9378251, rs201552310, rs397509367, rs6445, rs387906510, rs1474566961, rs7755898, rs72552754, rs151344503, rs151344504, rs1582299448, rs1582302625, rs72552757, rs80358217, rs80358220, rs80358221, rs121912974, rs28931607, rs72552772, rs72552771, rs28931608, rs786205875, rs121912976, rs1554299737, rs193922538, rs193922539, rs193922541, rs387907572, rs267606756, rs786204728, rs886038207, rs753774484, rs1554304513, rs1554305880, rs1429901248, rs767128094, rs367634557, rs936203749, rs1563435458, rs754609778, rs1563867837, rs776989258, rs1582298980, rs1582309414, rs1582300748, rs781805159, rs782336856, rs373613946, rs770199817, rs1582304457, rs1582304536, rs1582305275, rs182942340, rs1582307951, rs1367112998, rs1582312633, rs779791105, rs72552758, rs1447069098 |
9302260, 8506298, 20331679, 23940125, 15751602, 28228528, 2022736, 16046588, 16670167, 24022297, 26265915, 18663314, 8964882, 24987415, 26053152, 15755848, 24334966, 26476331, 26066897, 8768848, 22964742, 20947076, 17371482, 11549691, 26280318, 24536089, 15807871, 25911436, 17726333, 26956189, 20089618, 9435454, 10487675 |
Cryptorchidism |
Bilateral Cryptorchidism |
rs121912555, rs104894697, rs104894698, rs398122886 |
|
Hyperaldosteronism |
Hyperaldosteronism, Glucocorticoid-remediable aldosteronism, Familial hyperaldosteronism type I |
rs28934586, rs104894068, rs387906778, rs386352319, rs587777437, rs587777438, rs587777439, rs786205050, rs771507094, rs1085307938, rs1553853557, rs1553856214, rs1293789661, rs1553857113, rs758379595 |
11085685, 24817817, 20634641, 11549691 |
Hypertension |
Hypertensive disease |
rs13306026, rs13333226 |
|
Osteoporosis |
Osteoporosis |
rs72658152, rs72667023, rs587776916, rs72656370, rs768615287 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
11-beta-hydroxylase deficiency |
11-Beta-hydroxylase deficiency |
|
|
Adrenal hyperplasia |
Adrenal hyperplasia |
|
|
Adrenogenital syndrome |
Adrenogenital Syndrome |
|
|
Ambiguous genitalia |
Ambiguous genitalia, female |
rs782562963 |
|
Conn syndrome |
Conn Syndrome |
|
11085685 |
Dwarfism |
Dwarfism |
|
|
Ectopic adrenal gland |
Ectopic adrenal gland |
|
|
Enlarged polycystic ovaries |
Enlarged polycystic ovaries |
|
|
Female sexual dysfunction |
Female sexual dysfunction |
|
|
Gynecomastia |
Gynecomastia |
|
|
Hypernatriuria |
Hypernatriuria |
|
|
Hypertrophy of clitoris |
Hypertrophy of clitoris |
|
|
Hypoplasia of vagina |
Hypoplasia of vagina |
|
|
Premature adrenarche |
Premature adrenarche |
|
|
Secretory adrenocortical adenoma |
Secretory adrenocortical adenoma |
|
|
Stroke |
Cerebrovascular accident |
|
|
|
|
|