CPOX (coproporphyrinogen oxidase)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
1371 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Coproporphyrinogen oxidase |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
CPOX |
SynonymsGene synonyms aliases
|
COX, CPO, CPX, HARPO, HCP |
ChromosomeChromosome number
|
3 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
3q11.2 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
The protein encoded by this gene is the sixth enzyme of the heme biosynthetic pathway. The encoded enzyme is soluble and found in the intermembrane space of mitochondria. This enzyme catalyzes the stepwise oxidative decarboxylation of coproporphyrinogen I |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs28931603 |
G>A |
Pathogenic |
Non coding transcript variant, intron variant, missense variant, coding sequence variant |
rs121917866 |
G>A |
Pathogenic |
Non coding transcript variant, missense variant, coding sequence variant |
rs121917868 |
T>C |
Pathogenic, likely-pathogenic |
Non coding transcript variant, missense variant, intron variant, coding sequence variant |
rs121917870 |
G>A,C |
Pathogenic |
Non coding transcript variant, missense variant, coding sequence variant |
rs121917871 |
G>A,C |
Pathogenic |
Non coding transcript variant, stop gained, missense variant, coding sequence variant |
rs121917872 |
G>A |
Pathogenic |
Non coding transcript variant, missense variant, coding sequence variant |
rs121917873 |
G>A |
Pathogenic |
Non coding transcript variant, missense variant, coding sequence variant |
rs121917874 |
C>G |
Pathogenic |
Non coding transcript variant, missense variant, coding sequence variant |
rs370245685 |
T>C |
Pathogenic |
Intron variant |
rs576756431 |
A>T |
Pathogenic |
Stop gained, coding sequence variant, non coding transcript variant |
rs587777271 |
T>C |
Pathogenic |
Missense variant, coding sequence variant, non coding transcript variant |
rs781627991 |
C>G,T |
Conflicting-interpretations-of-pathogenicity |
Missense variant, non coding transcript variant, coding sequence variant |
rs786205053 |
->CGCTG |
Pathogenic |
Frameshift variant, non coding transcript variant, coding sequence variant |
rs786205054 |
TGCCAGAGCCTGGCACACCTG>- |
Pathogenic |
Inframe deletion, non coding transcript variant, coding sequence variant |
rs1553696121 |
->G |
Likely-pathogenic |
Frameshift variant, non coding transcript variant, coding sequence variant |
rs1559677768 |
->T |
Pathogenic |
Non coding transcript variant, frameshift variant, coding sequence variant |
rs1576304776 |
A>C |
Likely-pathogenic |
Splice donor variant |
rs1576306536 |
G>A |
Pathogenic |
Non coding transcript variant, coding sequence variant, stop gained |
rs1576306935 |
C>- |
Pathogenic |
Frameshift variant, non coding transcript variant, coding sequence variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P36551 |
Protein name |
Oxygen-dependent coproporphyrinogen-III oxidase, mitochondrial (COX) (Coprogen oxidase) (Coproporphyrinogenase) (EC 1.3.3.3) |
Protein function |
Catalyzes the aerobic oxidative decarboxylation of propionate groups of rings A and B of coproporphyrinogen-III to yield the vinyl groups in protoporphyrinogen-IX and participates to the sixth step in the heme biosynthetic pathway. {ECO:0000269| |
PDB |
2AEX
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF01218 |
Coprogen_oxidas |
151 → 453 |
Coproporphyrinogen III oxidase |
Family |
|
Sequence |
|
Sequence length |
454 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Anemia |
Anemia, Hemolytic, Congenital |
rs118204044, rs118204045, rs118204046, rs121918330, rs869320719, rs869312029, rs121918332, rs869320724, rs767094129, rs786205058, rs786205059, rs137853119, rs137853120, rs137853121, rs1384933966, rs137853122, rs137853123, rs786205060, rs267607121, rs121908584, rs80338697, rs80338699, rs120074166, rs120074167, rs1050828, rs74575103, rs137852314, rs5030868, rs137852316, rs137852317, rs137852318, rs137852319, rs137852320, rs137852321, rs137852322, rs137852323, rs137852324, rs72554665, rs387906468, rs5030872, rs137852326, rs137852333, rs137852327, rs137852328, rs137852329, rs137852330, rs137852331, rs137852332, rs137852334, rs137852335, rs137852336, rs137852339, rs76645461, rs137852340, rs137852341, rs78478128, rs137852343, rs137852344, rs137852345, rs587776730, rs137852346, rs137852347, rs137852349, rs2070404412, rs2070350038, rs2070350009, rs137852303, rs137852304, rs33946267, rs34378160, rs33933298, rs11549407, rs35724775, rs34598529, rs41469945, rs267607201, rs80338694, rs80338696, rs387907018, rs398123546, rs78365220, rs587777100, rs587777101, rs483352840, rs869312752, rs765487627, rs1557229599, rs1557230040, rs1555524842, rs782090947, rs1358275550, rs1557229736, rs1557230573, rs1556323334, rs1233124208, rs1293528130, rs146864395, rs1595503440, rs1603411214, rs137852325, rs1575247302, rs1603411177, rs1336651679, rs782322505 |
|
Coproporphyria |
Coproporphyria |
rs2107113853, rs786205053, rs786205054, rs121917870, rs121917871, rs121917872, rs121917873, rs1559677768, rs121917874 |
|
Harderoporphyria |
Harderoporphyria |
rs121917868, rs587777271 |
|
Hereditary coproporphyria |
Hereditary Coproporphyria |
rs1576306536, rs1374394802 |
9048920, 11831056, 8990017, 27604308, 9298818, 9888388, 16398658, 8012360, 15896662, 7849704, 7757079, 12181641 |
Hypertension |
Hypertensive disease |
rs13306026, rs13333226 |
|
Porphyria cutanea tarda |
Porphyria Cutanea Tarda |
rs121918057, rs145195562, rs121918062, rs121918063, rs121918064, rs121918065, rs397514764, rs397514765, rs143823335, rs1569967143 |
11831056 |
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Anxiety disorder |
Anxiety |
|
|
Hallucinations |
Hallucinations |
|
|
Hypertrichosis |
Hypertrichosis |
|
|
Mental depression |
Depressive disorder |
rs587778876, rs587778877 |
|
Nervous system diseases |
Peripheral Nervous System Diseases |
|
|
Paranoia |
Paranoia |
|
|
|
|
|