ANTXR2 (ANTXR cell adhesion molecule 2)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
118429 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
ANTXR cell adhesion molecule 2 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
ANTXR2 |
SynonymsGene synonyms aliases
|
CMG-2, CMG2, HFS, ISH, JHF |
ChromosomeChromosome number
|
4 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
4q21.21 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs137852901 |
T>A,C |
Pathogenic |
Missense variant, coding sequence variant |
rs137852902 |
C>T |
Pathogenic |
Missense variant, coding sequence variant |
rs137852903 |
A>C |
Pathogenic |
Missense variant, coding sequence variant |
rs137852904 |
C>A,T |
Pathogenic |
Stop gained, coding sequence variant, missense variant |
rs137852905 |
A>G |
Pathogenic |
Missense variant, coding sequence variant |
rs312262690 |
->G,GG |
Pathogenic |
Coding sequence variant, frameshift variant |
rs312262693 |
A>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs546102223 |
C>T |
Pathogenic |
Coding sequence variant, synonymous variant |
rs797045028 |
G>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs797045029 |
A>G |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs886039907 |
C>T |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs886041401 |
A>C,G |
Pathogenic, likely-pathogenic |
Coding sequence variant, intron variant, missense variant |
rs1057521726 |
C>A,T |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1553933367 |
->T |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1560998734 |
ACATTCTGTGGCTGTGACAATTAATGATCCTGAAATGACAGATTTTCCTCCATTAAAGCTCACTGAAACATCAAGAGTT>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
rs1578125066 |
->C |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1578172709 |
->T |
Likely-pathogenic |
Coding sequence variant, stop gained |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P58335 |
Protein name |
Anthrax toxin receptor 2 (Capillary morphogenesis gene 2 protein) (CMG-2) |
Protein function |
Necessary for cellular interactions with laminin and the extracellular matrix. ; (Microbial infection) Receptor for the protective antigen (PA) of B.anthracis (PubMed:12700348, |
PDB |
1SHT
,
1SHU
,
1T6B
,
1TZN
,
7N1O
,
8FT6
,
8FT8
,
8FZ4
,
8FZU
,
8FZV
,
9DOC
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF00092 |
VWA |
44 → 212 |
von Willebrand factor type A domain |
Domain |
PF05587 |
Anth_Ig |
216 → 317 |
Anthrax receptor extracellular domain |
Domain |
PF05586 |
Ant_C |
394 → 484 |
Anthrax receptor C-terminus region |
Family |
|
Sequence |
|
Sequence length |
489 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Brachydactyly |
Brachydactyly |
rs121908949, rs28937580, rs121909082, rs104894122, rs863223289, rs863223290, rs104894121, rs1587657302, rs863223292, rs74315386, rs74315387, rs28936397, rs753691079, rs121909348, rs121917852, rs121917853, rs121917854, rs121917855, rs121917859, rs121917861, rs267606873, rs267606872, rs267606985, rs267606986, rs267606987, rs267606988, rs28933082, rs397514519, rs869025613, rs869025614, rs886039878, rs1553540620, rs1057518333, rs1948841937, rs1948868228, rs1948842030, rs1948842142 |
|
Developmental delay |
Gross motor development delay |
rs28941770, rs199469464, rs281865469, rs143747297, rs398123009, rs587777428, rs786205133, rs606231459, rs797044854, rs797045027, rs864309504, rs878853160, rs886039902, rs886042046, rs886041291, rs886041382, rs1057518991, rs1057518699, rs753254213, rs748294403, rs762552974, rs1135401795, rs1553121073, rs1553122926, rs1364690005, rs1554086554, rs1554210415, rs1554168326, rs1554776342, rs1553873247, rs1567860112, rs779009256, rs1557447255, rs1564568350, rs780011005, rs1597464953, rs1200336864, rs1569513017, rs1587459606, rs1570332505, rs748888652, rs1575155995, rs2087029320, rs1589669105, rs1601769604, rs1184981709, rs749201074 |
|
Fibromatosis |
Fibromatosis |
rs397517148, rs397517154, rs1553904077, rs1553904346, rs1553354396, rs727505093 |
14508707, 12973667 |
Hyaline fibromatosis syndrome |
Juvenile hyaline fibromatosis |
rs546102223, rs137852901, rs137852902, rs137852903, rs137852904, rs137852905, rs312262690, rs797045028, rs797045029, rs886039907, rs886041401, rs312262693, rs1553933367, rs1560998734, rs1578125066, rs1578172709 |
|
Hypertension |
Hypertensive disease |
rs13306026, rs13333226 |
|
Macrocephaly |
Macrocephaly |
rs786204854, rs764333096, rs1557739557 |
|
Narcolepsy |
Narcolepsy |
rs104894574, rs387906655 |
19629137 |
Osteoporosis |
Osteoporosis, Age-Related, Osteoporosis, Osteoporosis, Senile, Post-Traumatic Osteoporosis |
rs72658152, rs72667023, rs587776916, rs72656370, rs768615287 |
12973667 |
Prostate cancer |
Malignant neoplasm of prostate |
rs121909139, rs121909140, rs121909141, rs121909142, rs121909143, rs606231169, rs606231170, rs137852584, rs137852578, rs137852580, rs137852581, rs137852582 |
29662167 |
Protein-losing enteropathy |
COMPLEMENT HYPERACTIVATION, ANGIOPATHIC THROMBOSIS, AND PROTEIN-LOSING ENTEROPATHY |
rs1114167430, rs1135402914, rs1135402915, rs1135402916, rs1135402917, rs1135402918 |
|
Psoriasis |
Psoriasis |
rs281875215, rs587777763, rs281875213, rs281875212 |
26974007 |
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Ankylosing spondylitis |
Ankylosing spondylitis |
|
20062062, 21743469, 26974007 |
Cholangitis |
Cholangitis, Sclerosing |
|
26974007 |
Crohn disease |
Crohn Disease |
rs2066847, rs2066844, rs886052047, rs5743265, rs111608429, rs104895438 |
26974007 |
Dwarfism |
Dwarfism |
|
|
Elbow flexion contracture |
Flexion contracture - elbow |
|
|
Fibroma |
fibroma |
|
12973667, 14508707 |
Gingival hypertrophy |
Gingival Hypertrophy |
|
12973667, 14508707 |
Hyalinosis |
Hyalinosis, Systemic |
|
12973667, 14508707, 15725249, 26633545, 23386947 |
Immunologic deficiency syndromes |
Immunologic Deficiency Syndromes |
|
|
Micromelia |
Micromelia |
|
|
Myxofibroma |
Myxofibroma |
|
12973667, 14508707 |
Osteopenia |
Osteopenia |
|
|
Polycystic ovary syndrome |
Polycystic Ovary Syndrome |
|
|
Prostatic neoplasms |
Prostatic Neoplasms |
|
29662167 |
Rickets |
Adult Rickets |
|
|
Systemic hyalinosis |
Infantile systemic hyalinosis |
|
|
Thrombocytosis |
Thrombocytosis |
|
|
Ulcerative colitis |
Ulcerative Colitis |
|
26974007 |
Urticaria |
Urticaria |
|
|
|
|
|