CHST14 (carbohydrate sulfotransferase 14)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
113189 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Carbohydrate sulfotransferase 14 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
CHST14 |
SynonymsGene synonyms aliases
|
ATCS, D4ST1, EDSMC1, HNK1ST |
ChromosomeChromosome number
|
15 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
15q15.1 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene encodes a member of the HNK-1 family of sulfotransferases. The encoded protein transfers sulfate to the C-4 hydroxyl of N-acetylgalactosamine residues in dermatan sulfate. Mutations in this gene have been associated with adducted thumb-clubfoot |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs121908257 |
G>C |
Pathogenic |
Missense variant, coding sequence variant |
rs121908258 |
A>G |
Likely-pathogenic, pathogenic |
Missense variant, coding sequence variant |
rs139229738 |
T>C |
Likely-benign, conflicting-interpretations-of-pathogenicity |
Coding sequence variant, synonymous variant |
rs144629123 |
T>C |
Uncertain-significance, conflicting-interpretations-of-pathogenicity |
Missense variant, coding sequence variant |
rs267606727 |
C>G,T |
Pathogenic |
Coding sequence variant, missense variant |
rs267606728 |
T>A |
Pathogenic |
Coding sequence variant, missense variant |
rs267606729 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs267606730 |
A>T |
Pathogenic |
Coding sequence variant, stop gained |
rs267606731 |
G>C |
Pathogenic |
Coding sequence variant, missense variant |
rs397514706 |
G>C,T |
Pathogenic |
Coding sequence variant, missense variant |
rs397518432 |
G>- |
Pathogenic |
Coding sequence variant, stop gained |
rs794726956 |
G>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1247205097 |
G>A |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1555410747 |
->C |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1555410768 |
GCCCTGCAGGCGACGATGTCACATTCCCCGAGTTCCTGAGATACCTGGTGGATGAGGACCCTGAGCGCATGAATGAGCATTGGATGCCCGTGTACCA>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1555410784 |
C>T |
Likely-pathogenic |
Stop gained, coding sequence variant |
rs1555410785 |
->GTACCGGCCAGCCAGCCCCG |
Pathogenic |
Coding sequence variant, frameshift variant |
rs1566969054 |
->A |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1595869290 |
G>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1595869467 |
TGGA>GACAG |
Pathogenic, likely-pathogenic |
Coding sequence variant, frameshift variant |
rs1595869602 |
->A |
Pathogenic |
Coding sequence variant, stop gained |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
Q8NCH0 |
Protein name |
Carbohydrate sulfotransferase 14 (EC 2.8.2.35) (Dermatan 4-sulfotransferase 1) (D4ST-1) (hD4ST1) |
Protein function |
Catalyzes the transfer of sulfate to position 4 of the N-acetylgalactosamine (GalNAc) residue of dermatan sulfate. Plays a pivotal role in the formation of 4-0-sulfated IdoA blocks in dermatan sulfate. Transfers sulfate to the C-4 hydroxyl of be |
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF03567 |
Sulfotransfer_2 |
139 → 365 |
Sulfotransferase family |
Domain |
|
Sequence |
|
Sequence length |
376 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Arthrogryposis multiplex congenita |
Arthrogryposis |
rs1586285494, rs80358233, rs137853305, rs1559154278, rs398124167, rs398124172, rs587780399, rs786204576, rs786204430, rs769345284, rs749355583, rs793888524, rs793888525, rs878854368, rs555445835, rs758105619, rs886041851, rs794727136, rs755239192, rs760715690, rs773952935, rs112610938, rs1057516676, rs1057516996, rs780022652, rs1057517399, rs1057517360, rs1057518353, rs1057517977, rs1064796311, rs779232987, rs775997446, rs1064797093, rs1064797094, rs1064797095, rs755500591, rs754272530, rs758247804, rs200731870, rs747179265, rs1553740233, rs776569219, rs375628303, rs775631800, rs781667543, rs1553548666, rs928945364, rs763364977, rs1458048713, rs1553883480, rs1472403020, rs1336053002, rs202048855, rs1197561990, rs755531536, rs1554112524, rs762133567, rs1553555882, rs934111355, rs1255744452, rs1366269616, rs1555734932, rs1553548207, rs752582527, rs1257495033, rs113525641, rs755863625, rs374929094, rs539819851, rs1366853918, rs1218073575, rs1553537512, rs1553552384, rs747564597, rs776059611, rs756726488, rs1357811155, rs1553939600, rs772009599, rs1255445731, rs1011425121, rs1553561697, rs1553551748, rs1553552413, rs760935667, rs1553603400, rs1302373559, rs1389892619, rs1553710982, rs757157808, rs1180339426, rs761964375, rs1235589246, rs1443738549, rs1553934586, rs1553934597, rs1553603437, rs749452641, rs1553904694, rs754369875, rs112517981, rs774495973, rs1428597732, rs746999970, rs113091511, rs1553603958, rs1553469502, rs770797137, rs1553608621, rs1159756073, rs776167256, rs778593702, rs1553601066, rs1553689774, rs760768475, rs1559296376, rs201636991, rs1559039815, rs748922882, rs772366030, rs1207534366, rs1259297878, rs762780413, rs1559360386, rs1559940778, rs760200697, rs1344099907, rs750900690, rs1559168230, rs746177326, rs761067911, rs1323364980, rs537560378, rs1319778592, rs1340063197, rs1577833924, rs750585238, rs1600470099, rs1575714905, rs1576203853, rs779909544, rs760124743, rs2096362304, rs1212374733, rs1490309743, rs767709270, rs1374971806, rs2096491549, rs2097886912, rs2099021112, rs2097758221, rs1474341248, rs925947627 |
|
Atrial septal defect |
Atrial Septal Defects |
rs137852951, rs137852953, rs137852955, rs267607106, rs104893900, rs104893901, rs104893903, rs606231358, rs606231359, rs137852683, rs606231360, rs104893907, rs104894073, rs1585703301, rs104894074, rs267606903, rs121912677, rs387906585, rs387906773, rs72554028, rs587782928, rs587782929, rs587782930, rs587784067, rs1555226315, rs879253754, rs1114167356, rs773922431, rs1554093487, rs1554093433, rs1554093461, rs1561621507, rs1561619801, rs766692577, rs1581108237, rs1581111034, rs1579663872, rs1583066622, rs1456289029, rs1761430125 |
|
Cryptorchidism |
Cryptorchidism |
rs121912555, rs104894697, rs104894698, rs398122886 |
|
Developmental delay |
Global developmental delay |
rs28941770, rs199469464, rs281865469, rs143747297, rs398123009, rs587777428, rs786205133, rs606231459, rs797044854, rs797045027, rs864309504, rs878853160, rs886039902, rs886042046, rs886041291, rs886041382, rs1057518991, rs1057518699, rs753254213, rs748294403, rs762552974, rs1135401795, rs1553121073, rs1553122926, rs1364690005, rs1554086554, rs1554210415, rs1554168326, rs1554776342, rs1553873247, rs1567860112, rs779009256, rs1557447255, rs1564568350, rs780011005, rs1597464953, rs1200336864, rs1569513017, rs1587459606, rs1570332505, rs748888652, rs1575155995, rs2087029320, rs1589669105, rs1601769604, rs1184981709, rs749201074 |
|
Distal arthrogryposis |
Distal arthrogryposis syndrome |
rs121434638, rs104894127, rs104894129, rs137853305, rs137853306, rs199476153, rs199476147, rs121913619, rs879255230, rs387906657, rs387906658, rs199474721, rs587776917, rs587776918, rs587776919, rs587776920, rs587777129, rs587777130, rs587777131, rs199476146, rs606231471, rs370167241, rs765430577, rs878853117, rs878853118, rs1555621138, rs149459910, rs1553566820, rs1553567411, rs1553567937, rs1341894581, rs201987709, rs1554658995, rs1554289078, rs762979130, rs1554659746, rs1555242493, rs1555769818, rs1567973091, rs1563929039, rs1563929143, rs1350968647, rs1356994386, rs1229171141, rs1567559027, rs1563929383, rs113612402, rs1465836003, rs1597490381, rs1190799930, rs767987856, rs1587956195, rs1281970248, rs1575076514, rs1597482824, rs1825151618 |
|
Musculocontractural ehlers-danlos syndrome |
EHLERS-DANLOS SYNDROME, MUSCULOCONTRACTURAL TYPE 1, Ehlers-Danlos syndrome musculocontractural type, Musculocontractural Ehlers-Danlos syndrome |
rs121908257, rs121908258, rs267606729, rs267606730, rs267606731, rs1555410785, rs397514706, rs1555410768, rs1555410784, rs1247205097, rs1555410747, rs1566969054, rs1595869467, rs1595869602 |
20842734, 26373698, 20533528, 25703627, 26646600, 20004762, 26872206, 27604308, 22581468, 22987394 |
Glaucoma |
Glaucoma |
rs121918355, rs1566660365, rs1566635134, rs121918356, rs1566634475, rs28936700, rs55771538, rs28936701, rs104893622, rs55989760, rs72549387, rs104893628, rs2125316417, rs104893629, rs74315328, rs121909193, rs74315330, rs74315329, rs74315332, rs74315334, rs74315336, rs74315338, rs74315341, rs121909194, rs74315331, rs1558603396, rs387907175, rs587778873, rs587778875, rs104894979, rs137854895, rs766425037, rs72549380, rs148542782, rs541217363, rs753021890, rs771076928, rs56010818, rs777678299, rs1446110883, rs1573274915, rs1587545234, rs751768343, rs944452644 |
|
Myopia |
Myopia |
rs387907109, rs146936371, rs587776903, rs786205127, rs398122836, rs199624584, rs587777625, rs786205216, rs758872875, rs764211125, rs1135402746, rs765658563, rs1555941129, rs1555941116, rs199923805, rs782555528, rs1554862601, rs1586620121, rs1387950081, rs2051026773, rs1422332023 |
|
Hypotonia |
Neonatal Hypotonia |
rs141138948, rs397517172, rs869312824, rs1583169151 |
20842734 |
Nephrotic syndrome |
Nephrotic Syndrome |
rs876657369, rs121912601, rs121912602, rs876657370, rs121912603, rs121912604, rs121912605, rs121907900, rs121907901, rs28941778, rs587776576, rs28942089, rs587776577, rs28941777, rs121907910, rs1568296260, rs119473033, rs74315342, rs74315343, rs74315345, rs74315346, rs74315347, rs74315348, rs121434394, rs267606919, rs121912488, rs267606953, rs267606954, rs267606955, rs104886210, rs1591732280, rs1591750243, rs140511594, rs140781106, rs147972030, rs587776969, rs386833863, rs386833880, rs386833882, rs386833892, rs386833895, rs386833909, rs386833911, rs386833920, rs386833935, rs386833947, rs1555763603, rs398122978, rs398122979, rs398122980, rs369573693, rs398122981, rs398122982, rs398122983, rs200482683, rs730882194, rs180177201, rs587777552, rs587777553, rs775170915, rs749740335, rs12568913, rs530318579, rs786204583, rs786204708, rs786204632, rs138656762, rs797044992, rs797044994, rs797044995, rs864321632, rs864321687, rs864321688, rs864321633, rs869025495, rs869025541, rs869312747, rs145473779, rs757674160, rs869320695, rs138909849, rs869312984, rs1057516900, rs763818901, rs199506378, rs1057517164, rs1057516523, rs1057516414, rs778055996, rs1057516395, rs1057516747, rs1057516880, rs1057516680, rs778217926, rs1057519347, rs764587648, rs1060499703, rs121907903, rs769259446, rs1131692252, rs1131692253, rs1131692254, rs1131692255, rs1131692256, rs746887949, rs1131692235, rs1135402911, rs1135402912, rs1135402913, rs1554946480, rs1555331969, rs773173317, rs1555816634, rs775006954, rs1320543506, rs534522842, rs1272948499, rs1191455921, rs1291398331, rs1554939785, rs776016942, rs1031744496, rs748812981, rs755972674, rs1553312833, rs967339926, rs1462028977, rs1212702104, rs1167223941, rs762631237, rs1553316575, rs1553315173, rs1553316648, rs1553316611, rs780761368, rs368572297, rs1568070817, rs1321552081, rs1558108130, rs1558091788, rs1565707103, rs1558355124, rs1564622701, rs1351580598, rs1589475328, rs1589413498, rs1572255744, rs1572262824, rs761410195, rs1602413491, rs1590326226, rs375998390, rs570583897, rs369363545, rs201488687, rs1334894971, rs763782471, rs138047529, rs895782232, rs1572255047, rs1589433172, rs1589509476, rs1572277600, rs1572282458, rs1584675898, rs759043857, rs1853443391 |
|
Prostate cancer |
Malignant neoplasm of prostate |
rs121909139, rs121909140, rs121909141, rs121909142, rs121909143, rs606231169, rs606231170, rs137852584, rs137852578, rs137852580, rs137852581, rs137852582 |
27415467 |
Retinal detachment |
Retinal Detachment |
rs1555976049, rs1592230091 |
|
Scoliosis |
Scoliosis, unspecified |
rs1057518828, rs147296805, rs758163506, rs1555613564, rs1596852902, rs1596853067, rs1596853085 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Adducted thumbs syndrome |
Thumb in palm deformity |
|
20004762 |
Arachnodactyly |
Arachnodactyly |
|
|
Brachycephaly |
Brachycephaly |
|
|
Congenital clubfoot |
Congenital clubfoot |
|
20004762 |
Congenital exomphalos |
Congenital exomphalos |
|
|
Congenital malrotation of intestine |
Congenital malrotation of intestine |
|
|
Congenital pectus excavatum |
Congenital pectus excavatum |
|
|
Hiatal hernia |
Hiatal Hernia |
|
|
High palate |
Byzanthine arch palate |
|
|
Hydronephrosis |
Hydronephrosis |
|
|
Microcornea |
Microcornea |
|
|
Microstomia |
Microstomia |
|
|
Motor delay |
Clumsiness - motor delay |
|
|
Mouth abnormalities |
Mouth Abnormalities |
|
|
Posteriorly rotated ear |
Posteriorly rotated ear |
|
|
Prostatic neoplasms |
Prostatic Neoplasms |
|
27415467 |
Strabismus |
Strabismus |
|
|
|
|
|